G1315004



Basic Information


Item Value
gene id G1315004
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 61506184 ~ 61506590 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1500222
gggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtcctgacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaaaagggaaaaaatgtcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacaactgtaatcgcagcaaaaggtggcgctacaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1500222 True 407 TUCP 0.43 1 61506184 61506590
Loading

Neighbor


gene id symbol gene type direction distance location
trnas-uga-83 NA coding upstream 62035 61444076 ~ 61444149 (+)
LOC110490509 LOC106576412 coding upstream 200781 61278559 ~ 61305403 (+)
LOC110490508 LOC106576411 coding upstream 228189 61254071 ~ 61277995 (+)
LOC110490505 LOC106576416 coding upstream 307191 61194531 ~ 61198993 (+)
LOC110490498 LOC106609506 coding upstream 419407 61082171 ~ 61086777 (+)
LOC110490523 LOC106609523 coding downstream 100189 61606779 ~ 61611898 (+)
LOC110490530 LOC106576436 coding downstream 148802 61655392 ~ 61671638 (+)
LOC110490522 LOC106576392 coding downstream 255226 61761816 ~ 61780917 (+)
LOC110490549 NA coding downstream 380404 61886994 ~ 61889009 (+)
LOC110500016 NA coding downstream 403827 61910417 ~ 61912427 (+)
G1314999 NA non-coding upstream 2638 61503107 ~ 61503546 (+)
G1314712 NA non-coding upstream 20496 61477564 ~ 61485688 (+)
G1314711 NA non-coding upstream 20843 61475581 ~ 61485341 (+)
G1314710 NA non-coding upstream 23653 61474110 ~ 61482531 (+)
G1314701 NA non-coding upstream 43642 61462314 ~ 61462542 (+)
G1315021 NA non-coding downstream 15149 61521739 ~ 61522640 (+)
G1315022 NA non-coding downstream 16882 61523472 ~ 61523674 (+)
G1315047 NA non-coding downstream 29640 61536230 ~ 61536452 (+)
G1315054 NA non-coding downstream 33800 61540390 ~ 61540596 (+)
G1315063 NA non-coding downstream 40768 61547358 ~ 61547565 (+)
G1313256 NA other upstream 1405257 60098787 ~ 60100927 (+)
LOC110490480 LOC106576359 other upstream 1479573 60025063 ~ 60026611 (+)
G1313177 LOC106609379 other upstream 1504313 60000656 ~ 60001871 (+)
G1313204 LOC106576014 other upstream 1521276 59984329 ~ 59984908 (+)
lhfpl3 lhfpl3 other upstream 1533224 59935626 ~ 59977759 (+)
G1315081 NA other downstream 52990 61559580 ~ 61559958 (+)
G1315251 NA other downstream 328856 61835446 ~ 61836074 (+)
G1315291 NA other downstream 380474 61887064 ~ 61912414 (+)
G1315290 NA other downstream 391263 61897853 ~ 62006721 (+)
LOC110490554 LOC106576378 other downstream 546654 62053220 ~ 62055992 (+)

Expression


G1315004 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1315004 Expression in each Bioproject

Bar chart with 19 bars.
G1315004 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network