G1316040



Basic Information


Item Value
gene id G1316040
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 62954468 ~ 62954928 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1501490
gagtcatatgttggttgtttagggagagtcatatgttggttgtttagggagagtcatatgttggttgtttatggagagtcatatgttggttgtttagggagagtcatatgttggttgtttagggagagtcatatgttggttgtttagggagagtcatatgttggttgtttagggagagtcatctgttggttgtttagggagagtcatatgttggttgtttagggagagtcatatgttggttgtttagggagagtcatctgttggttgtttagggagagtcatctgttggttgtttagggagagtcatatgttggttgtttagggagagtcatatgttggttgtttagggagagtcatatgttggttgtttagggagagtcatctgttggttgtttagggagagtcatctgttggttgtttagggagagtcatatgttggttgtttagggagagtcatatgt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1501490 True 461 lncRNA 0.41 1 62954468 62954928

Neighbor


gene id symbol gene type direction distance location
LOC110490575 LOC106609039 coding upstream 104176 62844136 ~ 62850292 (+)
scyl2 scyl2 coding upstream 137634 62792914 ~ 62816834 (+)
depdc4 LOC106609043 coding upstream 161729 62786627 ~ 62792739 (+)
LOC110490567 anks1b coding upstream 364736 62231272 ~ 62589732 (+)
impdh1b LOC106576497 coding downstream 343420 63298348 ~ 63327816 (+)
LOC110490585 LOC106609575 coding downstream 428287 63383215 ~ 63407684 (+)
LOC110490586 LOC106609575 coding downstream 428438 63383366 ~ 63385748 (+)
LOC110490817 LOC106576481 coding downstream 1267156 64222084 ~ 64227831 (+)
pax4 LOC106576509 coding downstream 1451138 64406007 ~ 64408064 (+)
G1316039 NA non-coding upstream 477 62953668 ~ 62953991 (+)
G1316009 NA non-coding upstream 41927 62909837 ~ 62912541 (+)
G1316023 NA non-coding upstream 54195 62898926 ~ 62900273 (+)
G1315936 NA non-coding upstream 66118 62886525 ~ 62888350 (+)
G1316016 NA non-coding upstream 70458 62883799 ~ 62884010 (+)
G1316043 NA non-coding downstream 6766 62961694 ~ 62961914 (+)
G1316048 NA non-coding downstream 12940 62967868 ~ 62968099 (+)
G1316544 NA non-coding downstream 61511 63016439 ~ 63018294 (+)
G1316575 NA non-coding downstream 118967 63073895 ~ 63074275 (+)
G1316576 NA non-coding downstream 120604 63075532 ~ 63075967 (+)
G1316007 LOC100301653 other upstream 21946 62921704 ~ 62932522 (+)
G1315860 NA other upstream 339281 62614795 ~ 62615187 (+)
G1315679 NA other upstream 690452 62257134 ~ 62264016 (+)
G1315616 NA other upstream 807308 62100972 ~ 62147160 (+)
G1317320 NA other downstream 858912 63813840 ~ 63814369 (+)
G1317674 LOC106613263 other downstream 1434678 64389606 ~ 64390097 (+)
G1317686 LOC106576509 other downstream 1452081 64407009 ~ 64410034 (+)
G1317968 NA other downstream 2205048 65159976 ~ 65179127 (+)

Expression


G1316040 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1316040 Expression in each Bioproject

Bar chart with 3 bars.
G1316040 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network