G1316629



Basic Information


Item Value
gene id G1316629
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 63187764 ~ 63187987 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1502172
gaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgctaaatgtta

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1502172 True 224 lncRNA 0.41 1 63187764 63187987
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490575 LOC106609039 coding upstream 337472 62844136 ~ 62850292 (+)
scyl2 scyl2 coding upstream 370930 62792914 ~ 62816834 (+)
depdc4 LOC106609043 coding upstream 395025 62786627 ~ 62792739 (+)
LOC110490567 anks1b coding upstream 598032 62231272 ~ 62589732 (+)
impdh1b LOC106576497 coding downstream 110361 63298348 ~ 63327816 (+)
LOC110490585 LOC106609575 coding downstream 195228 63383215 ~ 63407684 (+)
LOC110490586 LOC106609575 coding downstream 195379 63383366 ~ 63385748 (+)
LOC110490817 LOC106576481 coding downstream 1034097 64222084 ~ 64227831 (+)
pax4 LOC106576509 coding downstream 1218079 64406007 ~ 64408064 (+)
G1316627 NA non-coding upstream 2282 63185246 ~ 63185482 (+)
G1316591 NA non-coding upstream 13642 63109861 ~ 63174122 (+)
G1316598 NA non-coding upstream 67913 63118737 ~ 63119851 (+)
G1316590 NA non-coding upstream 79240 63108291 ~ 63108524 (+)
G1316576 NA non-coding upstream 111797 63075532 ~ 63075967 (+)
G1316631 NA non-coding downstream 1505 63189492 ~ 63189705 (+)
G1316644 NA non-coding downstream 36806 63224793 ~ 63225047 (+)
G1316618 NA non-coding downstream 45290 63233277 ~ 63233678 (+)
G1316658 LOC106609576 non-coding downstream 69731 63257718 ~ 63259215 (+)
G1316660 NA non-coding downstream 73934 63261921 ~ 63275255 (+)
G1316007 LOC100301653 other upstream 255242 62921704 ~ 62932522 (+)
G1315860 NA other upstream 572577 62614795 ~ 62615187 (+)
G1315679 NA other upstream 923748 62257134 ~ 62264016 (+)
G1315616 NA other upstream 1040604 62100972 ~ 62147160 (+)
G1317320 NA other downstream 625853 63813840 ~ 63814369 (+)
G1317674 LOC106613263 other downstream 1201619 64389606 ~ 64390097 (+)
G1317686 LOC106576509 other downstream 1219022 64407009 ~ 64410034 (+)
G1317968 NA other downstream 1971989 65159976 ~ 65179127 (+)

Expression


G1316629 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

G1316629 Expression in each Bioproject

Bar chart with 14 bars.
G1316629 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network