G1317320


Basic Information

Item Value
gene id G1317320
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 63813840 ~ 63814369 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1502950
gaagtgaggtttgggggccactcaataaactggattttaaaatgtgggacaaacatccaattgaagccctacatgcagaattctgtcggaaaattctgcaagtccagagaaatacaccaactaatgcgtgtagggcagaattgggccgttttccagtaataatgaaaatacagaaaagatcattaaaattttggctacatctaaattcaagtccaaattcgagtctgcaatttaaagcacttcaagcccaagagctgagcccagaaacgagccctctcagtcagctggtgttggacctcaccaatcaagctgacaccagcactgcttcaaaagaaagaattccaataagcaaaatcatgaaccaatcaaaggaatcatatttacaatactggaaaaacgaaacaaaatcccaaagccgactaaattgctatctgaccctaaacagagaatatgaattggctgattatctctactctgtcagagatacgaagcagagacagatccttaccaagtacaggctgagtgaccac

Function

NR:

description
PREDICTED: uncharacterized protein LOC109079796

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1502950 True 530 TUCP 0.41 1 63813840 63814369
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110490585 LOC106609575 coding upstream 406156 63383215 ~ 63407684 (+)
LOC110490586 LOC106609575 coding upstream 428092 63383366 ~ 63385748 (+)
impdh1b LOC106576497 coding upstream 486024 63298348 ~ 63327816 (+)
LOC110490575 LOC106609039 coding upstream 963548 62844136 ~ 62850292 (+)
scyl2 scyl2 coding upstream 997006 62792914 ~ 62816834 (+)
LOC110490817 LOC106576481 coding downstream 407715 64222084 ~ 64227831 (+)
pax4 LOC106576509 coding downstream 591697 64406007 ~ 64408064 (+)
LOC118938929 LOC106576509 coding downstream 594544 64408913 ~ 64410363 (+)
LOC110499870 NA coding downstream 729766 64544135 ~ 64552715 (+)
LOC110510792 wnt5b coding downstream 888412 64702781 ~ 64824029 (+)
G1317179 NA non-coding upstream 65758 63742166 ~ 63748082 (+)
G1317187 NA non-coding upstream 98193 63715417 ~ 63715647 (+)
G1317184 NA non-coding upstream 102999 63710634 ~ 63710841 (+)
G1317182 NA non-coding upstream 106108 63707489 ~ 63707732 (+)
G1317140 NA non-coding upstream 181123 63632420 ~ 63632717 (+)
G1317325 NA non-coding downstream 10322 63824691 ~ 63824929 (+)
G1317358 NA non-coding downstream 66687 63881056 ~ 63881311 (+)
G1317436 NA non-coding downstream 183294 63997663 ~ 64020208 (+)
G1317447 NA non-coding downstream 184609 63998978 ~ 64005213 (+)
G1317448 NA non-coding downstream 184877 63999246 ~ 64003023 (+)
G1316007 LOC100301653 other upstream 881318 62921704 ~ 62932522 (+)
G1315860 NA other upstream 1198653 62614795 ~ 62615187 (+)
LOC110490567 anks1b other upstream 1338326 62231272 ~ 62589732 (+)
G1315679 NA other upstream 1549824 62257134 ~ 62264016 (+)
G1317674 LOC106613263 other downstream 575237 64389606 ~ 64390097 (+)
G1317686 LOC106576509 other downstream 592640 64407009 ~ 64410034 (+)
G1317968 NA other downstream 1345607 65159976 ~ 65179127 (+)
LOC110518394 LOC107732972 other downstream 1477433 65291802 ~ 65866042 (+)
G1318650 NA other downstream 1625049 65439418 ~ 65440249 (+)

Expression

G1317320 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1317320 Expression in each Bioproject

Bar chart with 20 bars.
G1317320 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network