G1318548



Basic Information


Item Value
gene id G1318548
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 65220441 ~ 65220863 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1504531
atagggaatagggctctggtcaacagtagtgcactatatagggaatagggccctggtcaacagtagtgcactatatagggaatagggccctggtaaacagtagtgcactatatagggaatagggctctggtcaacagtagtacagtatatagggaatagggctctggtctaaagtagtgcactatatagggaatagggctctggtctaaagtagtgcactatatagggaatagggctctggactaaagtagtgcactatatagggaatagggctctggtctaaagtagtgcactatatagggaatagggctctggtctaaagtagtgcactatatagggaatagggctctggtctaaagtagtgcactatatagggaatagggttg

Function


NR:

description
PREDICTED: uncharacterized protein LOC106562210, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1504531 True 386 lncRNA 0.44 2 65220441 65220863
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118938827 LOC106576471 coding downstream 161798 65021405 ~ 65058643 (-)
LOC118938826 NA coding downstream 206030 64995972 ~ 65014411 (-)
LOC110510812 NA coding downstream 219462 64997957 ~ 65000979 (-)
LOC110511498 NA coding downstream 235192 64960178 ~ 64998613 (-)
LOC110517393 LOC106576623 coding upstream 48127 65268990 ~ 65303134 (-)
LOC110512490 LOC106592130 coding upstream 657147 65878010 ~ 65892365 (-)
LOC110511373 LOC106592131 coding upstream 671585 65892448 ~ 65898819 (-)
LOC110511371 LOC106597280 coding upstream 680879 65901742 ~ 65979435 (-)
LOC110499707 LOC106609801 coding upstream 760778 65981641 ~ 65986435 (-)
G1318529 NA non-coding downstream 59799 65160011 ~ 65160642 (-)
G1318477 NA non-coding downstream 67154 65068277 ~ 65153287 (-)
G1318479 NA non-coding downstream 70355 65148421 ~ 65150086 (-)
G1318523 NA non-coding downstream 77710 65141433 ~ 65142731 (-)
G1318515 NA non-coding downstream 86339 65133652 ~ 65134102 (-)
G1318555 NA non-coding upstream 9126 65229989 ~ 65233914 (-)
G1318561 NA non-coding upstream 34624 65255487 ~ 65255864 (-)
G1318867 NA non-coding upstream 56493 65277356 ~ 65277930 (-)
G1318925 NA non-coding upstream 213075 65433938 ~ 65434153 (-)
G1318926 NA non-coding upstream 219225 65440088 ~ 65440350 (-)
LOC110499867 LOC106576572 other downstream 735123 64481916 ~ 64636502 (-)
G1318164 LOC106576481 other downstream 992766 64216504 ~ 64227675 (-)
G1318092 NA other downstream 1136553 64083037 ~ 64083888 (-)
G1316904 LOC106609576 other downstream 1932537 63256527 ~ 63287904 (-)
G1318935 NA other upstream 249104 65469967 ~ 65473164 (-)
G1319357 LOC106593594 other upstream 1058182 66279045 ~ 66282108 (-)
LOC110490781 LOC106576552 other upstream 1587584 66808409 ~ 66920061 (-)
G1319781 LOC106576551 other upstream 1635316 66856179 ~ 66862281 (-)
G1319847 NA other upstream 1740088 66960951 ~ 66961304 (-)

Expression


G1318548 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1318548 Expression in each Bioproject

Bar chart with 18 bars.
G1318548 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network