G1321997



Basic Information


Item Value
gene id G1321997
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 69562310 ~ 69563040 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1509018
gtttaatgtcgattgctcatgtttcttggccgaagcaagtctcttcttattattggtgtcttttagtagtggtttctttgcagcaatttgaccatgaaggcctgattcacgcagtctccgctgaacagttgatgttgagatgtgtctgttacttgaactatgtgaagcatttatttgggctgcaatttctgaggctggtaactgtaatgaacttattctctgcagcagaggtaactgtaatgaacttatcctctacagcagaagtaactctaatgaacttatcctctgtagcagaggtaactctaatgaacttatcctctgtagcagaggtaactctaatgaacttatcctctgtagcagaggtaactctaatgaacttatcctctgcagcagaggtaactgtaatgaacttatcctctacagcagaggtaactctaatgaacttatcttctgcagcagaggtaact

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1509018 True 467 TUCP 0.40 2 69562310 69563040

Neighbor


gene id symbol gene type direction distance location
LOC110511775 LOC106609789 coding downstream 36182 69513903 ~ 69526128 (-)
LOC110500968 LOC106609767 coding downstream 48907 69502537 ~ 69513403 (-)
LOC110499783 LOC106609772 coding downstream 131502 69424840 ~ 69430808 (-)
LOC110490621 kcnc2 coding downstream 145245 69333220 ~ 69417065 (-)
LOC110490620 pmpcb coding downstream 324500 69233713 ~ 69237810 (-)
LOC110499763 NA coding upstream 46705 69609745 ~ 69610345 (-)
LOC118936535 LOC106597692 coding upstream 48583 69611623 ~ 69614219 (-)
LOC110499760 LOC106609764 coding upstream 55928 69618968 ~ 69640830 (-)
LOC118938967 NA coding upstream 61960 69625000 ~ 69625129 (-)
LOC118938965 NA coding upstream 66618 69629658 ~ 69629794 (-)
G1321995 NA non-coding downstream 293 69561654 ~ 69562017 (-)
G1321994 NA non-coding downstream 1167 69560816 ~ 69561143 (-)
G1321988 NA non-coding downstream 10775 69551139 ~ 69551535 (-)
G1321978 NA non-coding downstream 20723 69541047 ~ 69541587 (-)
G1321939 NA non-coding downstream 56575 69447983 ~ 69505735 (-)
G1322201 NA non-coding upstream 1317 69564357 ~ 69564706 (-)
G1322206 NA non-coding upstream 9449 69572489 ~ 69573256 (-)
G1322211 NA non-coding upstream 39917 69602957 ~ 69603224 (-)
G1322212 NA non-coding upstream 41412 69604452 ~ 69604756 (-)
G1322213 NA non-coding upstream 44305 69607345 ~ 69608098 (-)
G1321729 NA other downstream 339282 69220303 ~ 69223028 (-)
LOC110490790 LOC106609779 other downstream 405311 69149477 ~ 69163694 (-)
G1321652 nrf1 other downstream 489034 69031026 ~ 69073276 (-)
LOC110513021 exoc4 other downstream 1385928 67998532 ~ 68239937 (-)
LOC118938833 LOC106608919 other downstream 1764475 67785217 ~ 67797863 (-)
G1322348 NA other upstream 335645 69897748 ~ 69899703 (-)
G1323036 NA other upstream 973412 70536452 ~ 70537139 (-)
LOC110490645 LOC106576589 other upstream 980316 70543356 ~ 70547418 (-)
G1323207 NA other upstream 1462211 71025251 ~ 71039522 (-)
G1323296 LOC106609674 other upstream 1639460 71202500 ~ 71237846 (-)

Expression


G1321997 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1321997 Expression in each Bioproject

Bar chart with 20 bars.
G1321997 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network