G1325895



Basic Information


Item Value
gene id G1325895
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 74075304 ~ 74087190 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1514134
actagtaacagtgactatagttcagggtactgggggagactagtaacagtgactatagttcagggtactggggggagactagtaacagtgactatagttcagggtactgggggagactagtaacagtgactatagttccgggcagggtactggggggagactagtaacagtgactatagttcagggtactgggtggaggctagtaacagtgactatagttcagggtactgggtggagactagtaacagtgactatagttcagggcagggtactg

Function


NR:

description
serine/arginine repetitive matrix protein 2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1514134 True 274 lncRNA 0.49 3 74075304 74087190
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110527628 dera coding downstream 89803 73972321 ~ 73985501 (-)
LOC118938901 NA coding downstream 145504 73920453 ~ 73929800 (-)
mgst1.1 LOC106590880 coding downstream 173136 73884283 ~ 73902168 (-)
LOC118938851 LOC106575061 coding downstream 173173 73890918 ~ 73902131 (-)
LOC118938934 LOC106594503 coding downstream 736943 73337025 ~ 73338361 (-)
LOC110513406 LOC106576618 coding upstream 80008 74167198 ~ 74213128 (-)
LOC110511321 lemd3 coding upstream 131712 74218902 ~ 74256009 (-)
LOC110491887 tmbim4 coding upstream 270936 74358126 ~ 74374229 (-)
LOC118938857 NA coding upstream 274409 74361599 ~ 74366042 (-)
LOC110514977 NA coding upstream 332738 74419928 ~ 74421766 (-)
G1325888 NA non-coding downstream 9837 74065087 ~ 74065467 (-)
G1325869 NA non-coding downstream 61123 74013982 ~ 74014181 (-)
G1325867 NA non-coding downstream 65718 74009332 ~ 74009586 (-)
G1325866 NA non-coding downstream 69921 74005141 ~ 74005383 (-)
G1325864 NA non-coding downstream 71976 74003053 ~ 74003328 (-)
G1325901 NA non-coding upstream 3057 74090247 ~ 74090807 (-)
G1325892 NA non-coding upstream 16286 74103476 ~ 74105912 (-)
G1325943 NA non-coding upstream 30318 74117508 ~ 74117782 (-)
G1325890 NA non-coding upstream 49506 74136696 ~ 74140081 (-)
G1325953 NA non-coding upstream 55283 74142473 ~ 74142680 (-)
G1325863 LOC106584099 other downstream 72555 74002447 ~ 74002749 (-)
G1325780 NA other downstream 340207 73734681 ~ 73735097 (-)
G1325752 NA other downstream 397651 73675338 ~ 73677653 (-)
G1324805 NA other downstream 1168953 72905449 ~ 72906351 (-)
LOC110531910 gsap other downstream 1542289 72500414 ~ 72533138 (-)
G1325915 b2m other upstream 288111 74375301 ~ 74395568 (-)
LOC118938855 LOC106576675 other upstream 518181 74602942 ~ 74607316 (-)
G1326070 NA other upstream 635399 74722589 ~ 74723400 (-)

Expression


G1325895 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1325895 Expression in each Bioproject

Bar chart with 9 bars.
G1325895 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network