G1326050



Basic Information


Item Value
gene id G1326050
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 74655431 ~ 74655659 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1514338
atacagagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagtctttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgtt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1514338 True 229 lncRNA 0.36 1 74655431 74655659

Neighbor


gene id symbol gene type direction distance location
LOC118938855 LOC106576675 coding downstream 49315 74602942 ~ 74607316 (-)
LOC118938856 LOC106576675 coding downstream 103233 74521099 ~ 74552198 (-)
LOC110514977 NA coding downstream 233665 74419928 ~ 74421766 (-)
LOC110491887 tmbim4 coding downstream 281202 74358126 ~ 74374229 (-)
LOC110514334 mdm2 coding upstream 118788 74774447 ~ 74797613 (-)
LOC110516942 LOC106576641 coding upstream 144904 74800563 ~ 74805861 (-)
LOC110514333 nu107 coding upstream 150350 74806009 ~ 74876319 (-)
LOC110490689 rap1b coding upstream 227370 74883029 ~ 74988331 (-)
LOC118938932 NA coding upstream 534962 75190621 ~ 75191934 (-)
G1326047 NA non-coding downstream 8586 74646326 ~ 74646845 (-)
G1326046 NA non-coding downstream 20662 74633885 ~ 74634769 (-)
G1325931 NA non-coding downstream 40824 74608944 ~ 74614607 (-)
G1326039 NA non-coding downstream 46507 74608718 ~ 74608924 (-)
G1326038 NA non-coding downstream 46805 74608333 ~ 74608626 (-)
G1326053 NA non-coding upstream 6256 74661915 ~ 74662303 (-)
G1326055 NA non-coding upstream 11367 74667026 ~ 74667659 (-)
G1326056 NA non-coding upstream 20984 74676643 ~ 74677259 (-)
G1326059 NA non-coding upstream 27736 74683395 ~ 74683648 (-)
G1326060 NA non-coding upstream 31706 74687365 ~ 74687712 (-)
G1325915 b2m other downstream 259863 74375301 ~ 74395568 (-)
LOC110511321 lemd3 other downstream 420617 74218902 ~ 74256009 (-)
LOC110513406 LOC106576618 other downstream 442565 74167198 ~ 74213128 (-)
G1325863 LOC106584099 other downstream 652682 74002447 ~ 74002749 (-)
G1326070 NA other upstream 66930 74722589 ~ 74723400 (-)
G1326095 NA other upstream 116640 74772299 ~ 74773953 (-)
G1326164 NA other upstream 397090 75052749 ~ 75053357 (-)
G1326996 NA other upstream 1342847 75998506 ~ 75999000 (-)
LOC110515635 LOC106576658 other upstream 2762662 77418263 ~ 77506802 (-)

Expression


G1326050 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G1326050 Expression in each Bioproject

Bar chart with 18 bars.
G1326050 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network