G1326060



Basic Information


Item Value
gene id G1326060
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 74687365 ~ 74687712 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1514350
accactagctgtcttggggcctctcagtctactactaccaccaccactagctgtcttggggcctctcagtctactactactaccactagctgtcttggggcctctcagtctactaccaccactagctgtcttggggcctctcagtctactactactaccactagctgtcttggggcctctcagtctactaccaccactagctgtcttggggcctctcagtctactaccaccactagctgtcttggggcctctcagtctactactaccactagctgtcttggggcctctcagtctactaccaccactagctgtcttggggcctcagtctactactaccactagctgtct

Function


NR:

description
centrosomal protein of 170 kDa protein B-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1514350 True 348 lncRNA 0.54 1 74687365 74687712

Neighbor


gene id symbol gene type direction distance location
LOC118938855 LOC106576675 coding downstream 81249 74602942 ~ 74607316 (-)
LOC118938856 LOC106576675 coding downstream 135167 74521099 ~ 74552198 (-)
LOC110514977 NA coding downstream 265599 74419928 ~ 74421766 (-)
LOC110491887 tmbim4 coding downstream 313136 74358126 ~ 74374229 (-)
LOC110514334 mdm2 coding upstream 86735 74774447 ~ 74797613 (-)
LOC110516942 LOC106576641 coding upstream 112851 74800563 ~ 74805861 (-)
LOC110514333 nu107 coding upstream 118297 74806009 ~ 74876319 (-)
LOC110490689 rap1b coding upstream 195317 74883029 ~ 74988331 (-)
LOC118938932 NA coding upstream 502909 75190621 ~ 75191934 (-)
G1326059 NA non-coding downstream 3717 74683395 ~ 74683648 (-)
G1326056 NA non-coding downstream 10106 74676643 ~ 74677259 (-)
G1326055 NA non-coding downstream 19706 74667026 ~ 74667659 (-)
G1326053 NA non-coding downstream 25062 74661915 ~ 74662303 (-)
G1326050 NA non-coding downstream 31706 74655431 ~ 74655659 (-)
G1326062 NA non-coding upstream 8084 74695796 ~ 74696057 (-)
G1326063 NA non-coding upstream 10233 74697945 ~ 74698269 (-)
G1326066 NA non-coding upstream 29876 74717588 ~ 74718372 (-)
G1326071 NA non-coding upstream 35835 74723547 ~ 74724749 (-)
G1326072 NA non-coding upstream 37489 74725201 ~ 74726123 (-)
G1325915 b2m other downstream 291797 74375301 ~ 74395568 (-)
LOC110511321 lemd3 other downstream 452551 74218902 ~ 74256009 (-)
LOC110513406 LOC106576618 other downstream 474499 74167198 ~ 74213128 (-)
G1325863 LOC106584099 other downstream 684616 74002447 ~ 74002749 (-)
G1326070 NA other upstream 34877 74722589 ~ 74723400 (-)
G1326095 NA other upstream 84587 74772299 ~ 74773953 (-)
G1326164 NA other upstream 365037 75052749 ~ 75053357 (-)
G1326996 NA other upstream 1310794 75998506 ~ 75999000 (-)
LOC110515635 LOC106576658 other upstream 2730609 77418263 ~ 77506802 (-)

Expression



Co-expression Network