G1326151



Basic Information


Item Value
gene id G1326151
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 75026043 ~ 75026303 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1514479
gaacatttgaacatcttgaccatgttttgttataatctccacccggcacagccagaagaggactggccaccccacatagcctggttcctctctaggtttcttcctaggttttggcctttctagggagtttttcctagccaccgtgcttcttcacctgcattgcttgctgtttggggttttaggctgggtttctgtacagcactttgagatatcagctgatgtacgaagggctatataaaataaatttgatttgatttgaag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1514479 True 261 lncRNA 0.44 1 75026043 75026303
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490689 rap1b coding downstream 37712 74883029 ~ 74988331 (-)
LOC110514333 nu107 coding downstream 149724 74806009 ~ 74876319 (-)
LOC110516942 LOC106576641 coding downstream 220182 74800563 ~ 74805861 (-)
LOC110514334 mdm2 coding downstream 228430 74774447 ~ 74797613 (-)
LOC118938855 LOC106576675 coding downstream 419927 74602942 ~ 74607316 (-)
LOC118938932 NA coding upstream 164318 75190621 ~ 75191934 (-)
LOC110518764 LOC106576636 coding upstream 493998 75520301 ~ 75547039 (-)
LOC110490682 cand1 coding upstream 538305 75564608 ~ 75648161 (-)
LOC110513781 LOC106599032 coding upstream 1451246 76477549 ~ 76499886 (-)
LOC118936278 irak3 coding upstream 1473816 76500119 ~ 76525322 (-)
G1326135 NA non-coding downstream 49204 74974530 ~ 74976839 (-)
G1326125 NA non-coding downstream 99985 74925115 ~ 74926058 (-)
G1326123 NA non-coding downstream 102035 74922359 ~ 74924008 (-)
G1326117 NA non-coding downstream 123547 74901961 ~ 74902496 (-)
G1326113 NA non-coding downstream 133560 74891756 ~ 74892483 (-)
G1326157 NA non-coding upstream 9364 75035667 ~ 75036236 (-)
G1326158 NA non-coding upstream 10176 75036479 ~ 75036933 (-)
G1326161 NA non-coding upstream 15772 75042075 ~ 75098410 (-)
G1326174 NA non-coding upstream 43058 75069361 ~ 75073284 (-)
G1326261 NA non-coding upstream 83311 75109614 ~ 75201251 (-)
G1326095 NA other downstream 252090 74772299 ~ 74773953 (-)
G1326070 NA other downstream 302643 74722589 ~ 74723400 (-)
G1325915 b2m other downstream 630475 74375301 ~ 74395568 (-)
LOC110511321 lemd3 other downstream 791229 74218902 ~ 74256009 (-)
G1326164 NA other upstream 26446 75052749 ~ 75053357 (-)
G1326996 NA other upstream 972203 75998506 ~ 75999000 (-)
LOC110515635 LOC106576658 other upstream 2392018 77418263 ~ 77506802 (-)
G1328123 NA other upstream 2844976 77871279 ~ 77874604 (-)
LOC118938867 LOC106576670 other upstream 3272273 78298576 ~ 78452504 (-)

Expression


G1326151 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1326151 Expression in each Bioproject

Bar chart with 19 bars.
G1326151 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6000.
End of interactive chart.

Co-expression Network