G1326157



Basic Information


Item Value
gene id G1326157
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 75035667 ~ 75036236 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1514485
GTTTTCAGAAGACTCCCTCATTAAAACCAGGTCCTAGTCACTGTGTTGCCCTCGGTCGGGTTTTCAACAGACTCCCTCATTAAAACCAGGTCCTAGTCACTGTGTTGCCCTCGGTCGGGTTTTCAACAGACTCCCTCATTAAAACCAGATCCTAGTCACTGTGTTGCCCTCGGTCGGGTTTTCAACAGACTCCCTCATTAAAACCAGGTCCTAGTCAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1514485 True 218 lncRNA 0.49 2 75035667 75036236

Neighbor


gene id symbol gene type direction distance location
LOC110490689 rap1b coding downstream 47336 74883029 ~ 74988331 (-)
LOC110514333 nu107 coding downstream 159348 74806009 ~ 74876319 (-)
LOC110516942 LOC106576641 coding downstream 229806 74800563 ~ 74805861 (-)
LOC110514334 mdm2 coding downstream 238054 74774447 ~ 74797613 (-)
LOC118938855 LOC106576675 coding downstream 429551 74602942 ~ 74607316 (-)
LOC118938932 NA coding upstream 154385 75190621 ~ 75191934 (-)
LOC110518764 LOC106576636 coding upstream 484065 75520301 ~ 75547039 (-)
LOC110490682 cand1 coding upstream 528372 75564608 ~ 75648161 (-)
LOC110513781 LOC106599032 coding upstream 1441313 76477549 ~ 76499886 (-)
LOC118936278 irak3 coding upstream 1463883 76500119 ~ 76525322 (-)
G1326151 NA non-coding downstream 9364 75026043 ~ 75026303 (-)
G1326135 NA non-coding downstream 58828 74974530 ~ 74976839 (-)
G1326125 NA non-coding downstream 109609 74925115 ~ 74926058 (-)
G1326123 NA non-coding downstream 111659 74922359 ~ 74924008 (-)
G1326117 NA non-coding downstream 133171 74901961 ~ 74902496 (-)
G1326158 NA non-coding upstream 243 75036479 ~ 75036933 (-)
G1326161 NA non-coding upstream 5839 75042075 ~ 75098410 (-)
G1326174 NA non-coding upstream 33125 75069361 ~ 75073284 (-)
G1326261 NA non-coding upstream 73378 75109614 ~ 75201251 (-)
G1326281 NA non-coding upstream 114345 75150581 ~ 75151363 (-)
G1326095 NA other downstream 261714 74772299 ~ 74773953 (-)
G1326070 NA other downstream 312267 74722589 ~ 74723400 (-)
G1325915 b2m other downstream 640099 74375301 ~ 74395568 (-)
LOC110511321 lemd3 other downstream 800853 74218902 ~ 74256009 (-)
G1326164 NA other upstream 16513 75052749 ~ 75053357 (-)
G1326996 NA other upstream 962270 75998506 ~ 75999000 (-)
LOC110515635 LOC106576658 other upstream 2382085 77418263 ~ 77506802 (-)
G1328123 NA other upstream 2835043 77871279 ~ 77874604 (-)
LOC118938867 LOC106576670 other upstream 3262340 78298576 ~ 78452504 (-)

Expression


G1326157 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1326157 Expression in each Bioproject

Bar chart with 14 bars.
G1326157 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network