G1326325



Basic Information


Item Value
gene id G1326325
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 75276594 ~ 75277015 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1514716
tctaggtttataatctccacctggtacagccagaagaggactggccacccctcagagcctggttcctctctaggtttataatctccacctggtacagccagaagaggactggccacccctcagagcctggttcctctctaggtttctaatctccacctggtacagccagaagaggactggccacccctcagagcctggttcctctctaggtttctaatctccacctggtacagccagaagaggactggccacccctcagagcctggttcctctctaggtttataat

Function


NR:

description
PREDICTED: uncharacterized protein LOC106588115

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1514716 True 286 lncRNA 0.53 2 75276594 75277015

Neighbor


gene id symbol gene type direction distance location
LOC118938932 NA coding downstream 84660 75190621 ~ 75191934 (-)
LOC110490689 rap1b coding downstream 288263 74883029 ~ 74988331 (-)
LOC110514333 nu107 coding downstream 400275 74806009 ~ 74876319 (-)
LOC110516942 LOC106576641 coding downstream 470733 74800563 ~ 74805861 (-)
LOC110514334 mdm2 coding downstream 478981 74774447 ~ 74797613 (-)
LOC110518764 LOC106576636 coding upstream 243286 75520301 ~ 75547039 (-)
LOC110490682 cand1 coding upstream 287593 75564608 ~ 75648161 (-)
LOC110513781 LOC106599032 coding upstream 1200534 76477549 ~ 76499886 (-)
LOC118936278 irak3 coding upstream 1223104 76500119 ~ 76525322 (-)
LOC110514961 LOC106590998 coding upstream 1398106 76675121 ~ 76681446 (-)
G1326261 NA non-coding downstream 75343 75109614 ~ 75201251 (-)
G1326283 NA non-coding downstream 118701 75157283 ~ 75157893 (-)
G1326281 NA non-coding downstream 125231 75150581 ~ 75151363 (-)
G1326161 NA non-coding downstream 178184 75042075 ~ 75098410 (-)
G1326174 NA non-coding downstream 203310 75069361 ~ 75073284 (-)
G1326367 NA non-coding upstream 6376 75283391 ~ 75331634 (-)
G1326370 NA non-coding upstream 17834 75294849 ~ 75297541 (-)
G1326372 NA non-coding upstream 26472 75303487 ~ 75303857 (-)
G1326387 NA non-coding upstream 70009 75347024 ~ 75347304 (-)
G1326391 NA non-coding upstream 73927 75350942 ~ 75351303 (-)
G1326164 NA other downstream 223237 75052749 ~ 75053357 (-)
G1326095 NA other downstream 502641 74772299 ~ 74773953 (-)
G1326070 NA other downstream 553194 74722589 ~ 74723400 (-)
LOC118938855 LOC106576675 other downstream 669278 74602942 ~ 74607316 (-)
G1325915 b2m other downstream 881026 74375301 ~ 74395568 (-)
G1326996 NA other upstream 721491 75998506 ~ 75999000 (-)
LOC110515635 LOC106576658 other upstream 2141306 77418263 ~ 77506802 (-)
G1328123 NA other upstream 2594264 77871279 ~ 77874604 (-)
LOC118938867 LOC106576670 other upstream 3021561 78298576 ~ 78452504 (-)
G1328815 NA other upstream 3486084 78763099 ~ 78766048 (-)

Expression


G1326325 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1326325 Expression in each Bioproject

Bar chart with 19 bars.
G1326325 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network