G1326994



Basic Information


Item Value
gene id G1326994
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 75974030 ~ 75974457 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1515632
aaattttatttgtcacatacacatggttagcagatgttaatgtgagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataacaagtaatctaactaacaattccaaaactactgtcttgtacacagtgtaaggggataaagaatatgtacataaggatatatgaatgagtgatggtacagagcagcataggcaggatacagtagatggtatcgagtacagtatgtacaaatgagatgagtatgtaaacaaagtggcatagtttaaagtggctagtgatacatgtattacataaagatgcagtagatgatatagagtacagtatatacgtatgcatatgagatgaataatgtagggtaagtaacattatataaggtagcattgtttaaagtggctagtgatatattttacataatttcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1515632 True 428 lncRNA 0.33 1 75974030 75974457
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110490682 cand1 coding downstream 325869 75564608 ~ 75648161 (-)
LOC110518764 LOC106576636 coding downstream 426991 75520301 ~ 75547039 (-)
LOC118938932 NA coding downstream 782096 75190621 ~ 75191934 (-)
LOC110490689 rap1b coding downstream 985699 74883029 ~ 74988331 (-)
LOC110514333 nu107 coding downstream 1097711 74806009 ~ 74876319 (-)
LOC110513781 LOC106599032 coding upstream 503092 76477549 ~ 76499886 (-)
LOC118936278 irak3 coding upstream 525662 76500119 ~ 76525322 (-)
LOC110514961 LOC106590998 coding upstream 700664 76675121 ~ 76681446 (-)
LOC110512778 trhde coding upstream 897010 76871462 ~ 77277803 (-)
LOC118938902 NA coding upstream 1376821 77351278 ~ 77352450 (-)
G1326986 NA non-coding downstream 28782 75945024 ~ 75945248 (-)
G1326985 NA non-coding downstream 30836 75942979 ~ 75943194 (-)
G1326984 NA non-coding downstream 32803 75940911 ~ 75941227 (-)
G1326982 NA non-coding downstream 36832 75936266 ~ 75937198 (-)
G1326981 NA non-coding downstream 48077 75925417 ~ 75925953 (-)
G1326995 NA non-coding upstream 20734 75995191 ~ 75995518 (-)
G1327009 NA non-coding upstream 50120 76024577 ~ 76025754 (-)
G1327014 NA non-coding upstream 62181 76036638 ~ 76036924 (-)
G1327019 NA non-coding upstream 78358 76052815 ~ 76053237 (-)
G1327034 NA non-coding upstream 112160 76086617 ~ 76087718 (-)
G1326164 NA other downstream 920673 75052749 ~ 75053357 (-)
G1326095 NA other downstream 1200077 74772299 ~ 74773953 (-)
G1326070 NA other downstream 1250630 74722589 ~ 74723400 (-)
LOC118938855 LOC106576675 other downstream 1366714 74602942 ~ 74607316 (-)
G1325915 b2m other downstream 1578462 74375301 ~ 74395568 (-)
G1326996 NA other upstream 24049 75998506 ~ 75999000 (-)
LOC110515635 LOC106576658 other upstream 1443864 77418263 ~ 77506802 (-)
G1328123 NA other upstream 1896822 77871279 ~ 77874604 (-)
LOC118938867 LOC106576670 other upstream 2324119 78298576 ~ 78452504 (-)
G1328815 NA other upstream 2788642 78763099 ~ 78766048 (-)

Expression


G1326994 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1326994 Expression in each Bioproject

Bar chart with 18 bars.
G1326994 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network