G1327343



Basic Information


Item Value
gene id G1327343
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 76750498 ~ 76750734 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1516046
actgtaggggtgttgatagaggaagagggactgactgaggactgtaggggtgttgatagaggaagagggactgactgaggactgtaggggtgttgatagaggaagggggactgactgaggactgtaggggtgttgatagaggaagggggactgactgaggactgtaggggtgttgatagaggaagagggactgactgaggactgtaggggtgttgatagaggaagggggactgactg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1516046 True 237 lncRNA 0.54 1 76750498 76750734

Neighbor


gene id symbol gene type direction distance location
LOC118938861 grip1 coding upstream 279681 75732149 ~ 76472933 (+)
LOC118938860 NA coding upstream 1378435 75366958 ~ 75372063 (+)
LOC110499731 dyrk2 coding upstream 1384309 75332550 ~ 75366189 (+)
LOC118938859 LOC106593189 coding upstream 1477891 75251801 ~ 75272607 (+)
LOC118938933 ifngamma1 coding upstream 1521633 75224113 ~ 75228865 (+)
LOC118938862 NA coding downstream 665853 77416342 ~ 77505819 (+)
LOC118938903 NA coding downstream 1060107 77810841 ~ 77812644 (+)
LOC110490691 arhgef39 coding downstream 1208237 77958971 ~ 78066964 (+)
rergla LOC106609822 coding downstream 1344797 78095531 ~ 78107017 (+)
il17r il17r coding downstream 1372348 78123082 ~ 78148831 (+)
G1327342 NA non-coding upstream 152 76750029 ~ 76750346 (+)
G1327340 NA non-coding upstream 806 76749456 ~ 76749692 (+)
G1327315 NA non-coding upstream 38760 76711452 ~ 76711738 (+)
G1327311 NA non-coding upstream 45378 76704799 ~ 76705120 (+)
G1327259 LOC106590998 non-coding upstream 73703 76675906 ~ 76676795 (+)
G1327349 NA non-coding downstream 10895 76761629 ~ 76762173 (+)
G1327351 NA non-coding downstream 11767 76762501 ~ 76762786 (+)
G1327360 NA non-coding downstream 24404 76775138 ~ 76798768 (+)
G1327361 NA non-coding downstream 25908 76776642 ~ 76779598 (+)
G1327385 NA non-coding downstream 69977 76820711 ~ 76820924 (+)
G1327230 NA other upstream 160613 76587574 ~ 76589885 (+)
G1326605 NA other upstream 865351 75884811 ~ 75885147 (+)
G1326586 NA other upstream 943979 75805999 ~ 75806519 (+)
G1326503 cand1 other upstream 1151983 75593591 ~ 75598515 (+)
G1326467 NA other upstream 1223481 75522869 ~ 75527017 (+)
G1327379 NA other downstream 59126 76809860 ~ 76813288 (+)
G1328201 NA other downstream 1319295 78070029 ~ 78070403 (+)
LOC118936267 mrps33 other downstream 1998644 78749330 ~ 78763988 (+)
LOC118938871 braf other downstream 2029597 78780201 ~ 78826735 (+)

Expression


G1327343 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network