G1328516



Basic Information


Item Value
gene id G1328516
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 78466289 ~ 78466538 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1517713
gttcctagaccagttaacccaccgttcctagaccagttaaccaactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctagaccacttaacccactgttcctagaccacttaaccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1517713 True 250 lncRNA 0.48 1 78466289 78466538
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118938866 LOC108426397 coding upstream 188686 78225874 ~ 78277603 (+)
il17r il17r coding upstream 317458 78123082 ~ 78148831 (+)
rergla LOC106609822 coding upstream 359272 78095531 ~ 78107017 (+)
LOC110490691 arhgef39 coding upstream 399325 77958971 ~ 78066964 (+)
LOC118938903 NA coding upstream 653645 77810841 ~ 77812644 (+)
LOC118938868 LOC106591072 coding downstream 5059 78471597 ~ 78516510 (+)
LOC110507939 LOC106592658 coding downstream 47883 78514421 ~ 78516253 (+)
LOC110507940 LOC106592244 coding downstream 59450 78525988 ~ 78546160 (+)
trnaa-ugc-124 NA coding downstream 65932 78532470 ~ 78532540 (+)
LOC110510817 LOC106592244 coding downstream 183036 78649574 ~ 78658219 (+)
G1328515 NA non-coding upstream 1686 78464403 ~ 78464603 (+)
G1328314 NA non-coding upstream 34112 78429356 ~ 78432177 (+)
G1328285 NA non-coding upstream 113027 78352075 ~ 78353262 (+)
G1328284 NA non-coding upstream 119001 78346497 ~ 78347288 (+)
G1328280 NA non-coding upstream 130897 78332213 ~ 78335392 (+)
G1328518 NA non-coding downstream 123 78466661 ~ 78466904 (+)
G1328519 NA non-coding downstream 472 78467010 ~ 78467212 (+)
G1328520 NA non-coding downstream 1662 78468200 ~ 78468447 (+)
G1328523 NA non-coding downstream 3434 78469972 ~ 78470193 (+)
G1328524 NA non-coding downstream 3815 78470353 ~ 78518911 (+)
G1328201 NA other upstream 395886 78070029 ~ 78070403 (+)
G1327379 NA other upstream 1653001 76809860 ~ 76813288 (+)
G1327230 NA other upstream 1876404 76587574 ~ 76589885 (+)
G1326605 NA other upstream 2581142 75884811 ~ 75885147 (+)
LOC118936267 mrps33 other downstream 282840 78749330 ~ 78763988 (+)
LOC118938871 braf other downstream 313793 78780201 ~ 78826735 (+)
G1328968 NA other downstream 572066 79038604 ~ 79039457 (+)
G1329153 LOC106593057 other downstream 1151859 79618397 ~ 79621951 (+)
G1329159 NA other downstream 1197376 79663914 ~ 79664732 (+)

Expression


G1328516 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1328516 Expression in each Bioproject

Bar chart with 13 bars.
G1328516 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network