G1328524



Basic Information


Item Value
gene id G1328524
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 78470353 ~ 78518911 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1517721
ttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctcgaccagttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctagaccagttaacccactgttcctaggccgtcattgaaaataagaatttgttcttaactgacttgcctggttaaataaagg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1517721 True 280 lncRNA 0.45 2 78470353 78518911
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118938866 LOC108426397 coding upstream 192750 78225874 ~ 78277603 (+)
il17r il17r coding upstream 321522 78123082 ~ 78148831 (+)
rergla LOC106609822 coding upstream 363336 78095531 ~ 78107017 (+)
LOC110490691 arhgef39 coding upstream 403389 77958971 ~ 78066964 (+)
LOC118938903 NA coding upstream 657709 77810841 ~ 77812644 (+)
LOC110507940 LOC106592244 coding downstream 7077 78525988 ~ 78546160 (+)
trnaa-ugc-124 NA coding downstream 13559 78532470 ~ 78532540 (+)
LOC110510817 LOC106592244 coding downstream 130663 78649574 ~ 78658219 (+)
LOC118936267 mrps33 coding downstream 230419 78749330 ~ 78763988 (+)
LOC118938871 braf coding downstream 261290 78780201 ~ 78826735 (+)
G1328523 NA non-coding upstream 160 78469972 ~ 78470193 (+)
G1328520 NA non-coding upstream 1906 78468200 ~ 78468447 (+)
G1328519 NA non-coding upstream 3141 78467010 ~ 78467212 (+)
G1328518 NA non-coding upstream 3449 78466661 ~ 78466904 (+)
G1328516 NA non-coding upstream 3815 78466289 ~ 78466538 (+)
G1328546 NA non-coding downstream 5741 78524652 ~ 78524897 (+)
G1328561 NA non-coding downstream 46999 78565910 ~ 78586743 (+)
G1328548 NA non-coding downstream 52493 78571404 ~ 78573510 (+)
G1328583 NA non-coding downstream 95278 78614189 ~ 78615027 (+)
G1328596 NA non-coding downstream 112631 78631542 ~ 78632729 (+)
G1328201 NA other upstream 399950 78070029 ~ 78070403 (+)
G1327379 NA other upstream 1657065 76809860 ~ 76813288 (+)
G1327230 NA other upstream 1880468 76587574 ~ 76589885 (+)
G1326605 NA other upstream 2585206 75884811 ~ 75885147 (+)
G1328968 NA other downstream 519693 79038604 ~ 79039457 (+)
G1329153 LOC106593057 other downstream 1099486 79618397 ~ 79621951 (+)
G1329159 NA other downstream 1145003 79663914 ~ 79664732 (+)

Expression


G1328524 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1328524 Expression in each Bioproject

Bar chart with 20 bars.
G1328524 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network