G1328583



Basic Information


Item Value
gene id G1328583
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 78614189 ~ 78615027 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1517796
gaaaagttcaatatgggcccaaattttatcaaatggatcaaatcactatactctcatccaaatgccatggtgactactaatggactgaactctgacagattccctctggaacggggcacaagacaagggtgctcgctgtccccgctgctctacttcaatcaaatttattttatatagcccttcgtacatcagctgatatctcaaagtgctgtacagaaacccagcctaaaac

Function


NR:

description
reverse transcriptase, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1517796 True 232 lncRNA 0.43 2 78614189 78615027

Neighbor


gene id symbol gene type direction distance location
LOC110507940 LOC106592244 coding upstream 68029 78525988 ~ 78546160 (+)
trnaa-ugc-124 NA coding upstream 81649 78532470 ~ 78532540 (+)
LOC118938868 LOC106591072 coding upstream 97679 78471597 ~ 78516510 (+)
LOC110507939 LOC106592658 coding upstream 97936 78514421 ~ 78516253 (+)
LOC118938866 LOC108426397 coding upstream 336586 78225874 ~ 78277603 (+)
LOC110510817 LOC106592244 coding downstream 34547 78649574 ~ 78658219 (+)
LOC118936267 mrps33 coding downstream 134303 78749330 ~ 78763988 (+)
LOC118938871 braf coding downstream 165174 78780201 ~ 78826735 (+)
LOC118938872 large1 coding downstream 533438 79148465 ~ 79293033 (+)
LOC118938875 NA coding downstream 996667 79608818 ~ 79640460 (+)
G1328561 NA non-coding upstream 27446 78565910 ~ 78586743 (+)
G1328548 NA non-coding upstream 40679 78571404 ~ 78573510 (+)
G1328546 NA non-coding upstream 89292 78524652 ~ 78524897 (+)
G1328524 NA non-coding upstream 95278 78470353 ~ 78518911 (+)
G1328526 NA non-coding upstream 97687 78516038 ~ 78516502 (+)
G1328596 NA non-coding downstream 16515 78631542 ~ 78632729 (+)
G1328598 NA non-coding downstream 21796 78636823 ~ 78678612 (+)
G1328632 NA non-coding downstream 84756 78699783 ~ 78745994 (+)
G1328753 NA non-coding downstream 131465 78746492 ~ 78746705 (+)
G1328754 NA non-coding downstream 212762 78827789 ~ 78830869 (+)
G1328201 NA other upstream 543786 78070029 ~ 78070403 (+)
LOC110490691 arhgef39 other upstream 596378 77958971 ~ 78066964 (+)
G1327379 NA other upstream 1800901 76809860 ~ 76813288 (+)
G1327230 NA other upstream 2024304 76587574 ~ 76589885 (+)
G1326605 NA other upstream 2729042 75884811 ~ 75885147 (+)
G1328968 NA other downstream 423577 79038604 ~ 79039457 (+)
G1329153 LOC106593057 other downstream 1003370 79618397 ~ 79621951 (+)
G1329159 NA other downstream 1048887 79663914 ~ 79664732 (+)

Expression


G1328583 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1328583 Expression in each Bioproject

Bar chart with 13 bars.
G1328583 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network