G1329008



Basic Information


Item Value
gene id G1329008
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 79079387 ~ 79079637 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1518394
ttgtagcgccaccttttgctgcgattacagctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgaatttttttcccattcttccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1518394 True 251 lncRNA 0.43 1 79079387 79079637

Neighbor


gene id symbol gene type direction distance location
LOC118938871 braf coding upstream 252652 78780201 ~ 78826735 (+)
LOC118936267 mrps33 coding upstream 315399 78749330 ~ 78763988 (+)
LOC110510817 LOC106592244 coding upstream 421168 78649574 ~ 78658219 (+)
LOC110507940 LOC106592244 coding upstream 533227 78525988 ~ 78546160 (+)
LOC118938872 large1 coding downstream 68828 79148465 ~ 79293033 (+)
LOC118938875 NA coding downstream 532057 79608818 ~ 79640460 (+)
LOC118938878 NA coding downstream 639239 79718876 ~ 79720972 (+)
LOC110511598 LOC106595231 coding downstream 759761 79839398 ~ 79880370 (+)
LOC118936540 LOC106591976 coding downstream 1029443 80109080 ~ 80133699 (+)
G1329001 NA non-coding upstream 9016 79070065 ~ 79070371 (+)
G1328967 NA non-coding upstream 41906 79037056 ~ 79037481 (+)
G1328938 NA non-coding upstream 87019 78990160 ~ 78992368 (+)
G1328939 NA non-coding upstream 88325 78990275 ~ 78991062 (+)
G1328935 NA non-coding upstream 95229 78983664 ~ 78984158 (+)
G1329011 NA non-coding downstream 14203 79093840 ~ 79110355 (+)
G1329014 NA non-coding downstream 40840 79120477 ~ 79121372 (+)
G1329019 NA non-coding downstream 60287 79139924 ~ 79140330 (+)
G1329022 NA non-coding downstream 66114 79145751 ~ 79146594 (+)
G1329040 NA non-coding downstream 113097 79192734 ~ 79193310 (+)
G1328968 NA other upstream 39930 79038604 ~ 79039457 (+)
G1328201 NA other upstream 1008984 78070029 ~ 78070403 (+)
LOC110490691 arhgef39 other upstream 1061576 77958971 ~ 78066964 (+)
G1329153 LOC106593057 other downstream 538760 79618397 ~ 79621951 (+)
G1329159 NA other downstream 584277 79663914 ~ 79664732 (+)
G1329160 NA other downstream 585320 79664957 ~ 79667655 (+)
G1329273 NA other downstream 905956 79985593 ~ 79985951 (+)
G1329827 NA other downstream 1338827 80418464 ~ 80419259 (+)

Expression


G1329008 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1329008 Expression in each Bioproject

Bar chart with 16 bars.
G1329008 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network