G1329775



Basic Information


Item Value
gene id G1329775
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 80169182 ~ 80169445 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1519460
gacatgaaggtcagtccatcattactttaagacatgaaggtcagtccatcattactttaagacatgaaggtcagtccatcattactttaagacatgaaggtcagtccatcattactttaagacatgaaggtcagtccatcatcactttaagacatgaaggtcagtccatcattactttaagacatgaaggtcagtccatcattactttaagacatgaaggtcagtccatcattactttaagacatgaaggtcagtccatcgtta

Function


NR:

description
hypothetical protein EH28_02026

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1519460 True 264 lncRNA 0.38 1 80169182 80169445

Neighbor


gene id symbol gene type direction distance location
LOC118938879 LOC106591974 coding downstream 15484 80152103 ~ 80153698 (-)
LOC110510850 NA coding downstream 29751 80133088 ~ 80139431 (-)
LOC110510401 LOC106592932 coding downstream 84776 79910682 ~ 80084406 (-)
LOC118938877 LOC106594098 coding downstream 473713 79691618 ~ 79695469 (-)
LOC118938876 NA coding downstream 477877 79667754 ~ 79691305 (-)
LOC118938880 NA coding upstream 53576 80223008 ~ 80224268 (-)
LOC118938881 LOC106593769 coding upstream 65685 80235130 ~ 80241078 (-)
LOC110517959 LOC106593769 coding upstream 72744 80242189 ~ 80268839 (-)
LOC110516867 LOC106594631 coding upstream 117516 80286961 ~ 80347887 (-)
LOC110516866 NA coding upstream 199864 80369309 ~ 80370531 (-)
G1329774 NA non-coding downstream 4554 80164400 ~ 80164628 (-)
G1329770 NA non-coding downstream 37695 80129329 ~ 80131487 (-)
G1329765 NA non-coding downstream 42871 80125784 ~ 80126311 (-)
G1329665 NA non-coding downstream 60239 80108632 ~ 80108943 (-)
G1329776 NA non-coding upstream 962 80170407 ~ 80170641 (-)
G1329777 NA non-coding upstream 4959 80174404 ~ 80174643 (-)
G1329779 NA non-coding upstream 30887 80200332 ~ 80200586 (-)
LOC110510397 LOC106596262 non-coding upstream 39615 80151017 ~ 80231658 (-)
G1329780 NA non-coding upstream 52720 80222165 ~ 80222618 (-)
G1329577 NA other downstream 288822 79879408 ~ 79880360 (-)
G1329481 NA other downstream 601210 79567334 ~ 79567972 (-)
G1329752 NA other upstream 178816 80348261 ~ 80354313 (-)
G1329798 NA other upstream 183258 80352703 ~ 80353641 (-)
LOC118936542 LOC106592443 other upstream 201124 80370567 ~ 80391741 (-)

Expression


G1329775 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1329775 Expression in each Bioproject

Bar chart with 19 bars.
G1329775 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network