G1329699



Basic Information


Item Value
gene id G1329699
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 80251243 ~ 80251471 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1519332
ctggggtttcagtgatgtcagattgtagctggggttttattaatgtcagattgtagctggggtttcagtgatgtcagattgtagctggggtttcagtgacgtcagattgtagctggggtttcagtgatgtcagattgtagctggggtttcagtgatgtcagattgtagctggggtttcagtgacgtcagattgtagctggggtttcagtgacgtcagattgtagctggg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1519332 True 229 lncRNA 0.47 1 80251243 80251471
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110517730 LOC105026518 coding upstream 37953 80203140 ~ 80213290 (+)
LOC118936540 LOC106591976 coding upstream 117544 80109080 ~ 80133699 (+)
LOC110511598 LOC106595231 coding upstream 370873 79839398 ~ 79880370 (+)
LOC118938878 NA coding upstream 530271 79718876 ~ 79720972 (+)
LOC118938875 NA coding upstream 637500 79608818 ~ 79640460 (+)
LOC110517212 rtcb coding downstream 17473 80268944 ~ 80284094 (+)
LOC110516869 LOC106593275 coding downstream 96775 80348246 ~ 80354306 (+)
LOC118938966 NA coding downstream 97644 80349115 ~ 80349249 (+)
LOC118938906 NA coding downstream 478941 80730412 ~ 80731335 (+)
LOC118938882 cunh11orf98 coding downstream 585258 80836729 ~ 80841276 (+)
G1329698 NA non-coding upstream 248 80250763 ~ 80250995 (+)
G1329697 NA non-coding upstream 1787 80249131 ~ 80249456 (+)
G1329696 NA non-coding upstream 2488 80248437 ~ 80248755 (+)
G1329695 NA non-coding upstream 5558 80244495 ~ 80245685 (+)
G1329694 NA non-coding upstream 8149 80235137 ~ 80243094 (+)
G1329700 NA non-coding downstream 5262 80256733 ~ 80256953 (+)
G1329702 NA non-coding downstream 5660 80257131 ~ 80257660 (+)
G1329703 NA non-coding downstream 7513 80258984 ~ 80263051 (+)
G1329706 NA non-coding downstream 35001 80286472 ~ 80286750 (+)
G1329707 NA non-coding downstream 40231 80291702 ~ 80291925 (+)
G1329273 NA other upstream 265292 79985593 ~ 79985951 (+)
G1329160 NA other upstream 583588 79664957 ~ 79667655 (+)
G1329159 NA other upstream 586511 79663914 ~ 79664732 (+)
G1329153 LOC106593057 other upstream 629292 79618397 ~ 79621951 (+)
G1328968 NA other upstream 1211786 79038604 ~ 79039457 (+)
G1329827 NA other downstream 166993 80418464 ~ 80419259 (+)
G1329865 NA other downstream 238377 80489848 ~ 80490772 (+)
G1330026 NA other downstream 597872 80849343 ~ 80869367 (+)
tbk1 tbk1 other downstream 730713 80970502 ~ 81033922 (+)
G1330089 NA other downstream 761058 81012529 ~ 81013102 (+)

Expression


G1329699 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1329699 Expression in each Bioproject

Bar chart with 15 bars.
G1329699 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network