G1330089



Basic Information


Item Value
gene id G1330089
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 81012529 ~ 81013102 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1519927
cattatggggcattgtgatgtcattatggggtattgtgatgtcattatggggcattgtgatgtcattatggggtattgtgatgtcattatggggtattgtgatgtcattatggggcattgtgatgtcattatggggtattgtgatgtcattatggggtattgtgatgtcattatggggtattgtgatgtcattatggggtattgtgatgtcattatggggtattgtgatgtcattatggggtattgcaatgtcattatggggtattgtgatgtctttatggggtattgtgatgtcattatggggtattgtgatgtcattatggggtattgtgatgtcattatggggtattgtgatgtcattatggggtattgtgatgtcattatggggcattgtgatgtcattatggggcattgtgatgtcattatggggcattgtgatgtcattatggggtattgtgatgtcattatggggcattgtgatgtcattatggggtattgtgatgtcattatggggcattgtgatgtcattatggggcattgtgatgtcattatggggcattgtgatgtcattatg

Function


NR:

description
PREDICTED: coiled-coil domain-containing protein 70-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1519927 True 574 TUCP 0.40 1 81012529 81013102
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110512607 NA coding upstream 53189 80953309 ~ 80959340 (+)
LOC118936541 lrp6 coding upstream 58432 80873145 ~ 80954097 (+)
LOC118938882 cunh11orf98 coding upstream 171253 80836729 ~ 80841276 (+)
LOC118938906 NA coding upstream 281194 80730412 ~ 80731335 (+)
LOC118938966 NA coding upstream 663280 80349115 ~ 80349249 (+)
LOC110515350 gpr19 coding downstream 65511 81078613 ~ 81101324 (+)
LOC110514543 dusp16 coding downstream 117161 81130263 ~ 81196539 (+)
LOC110518769 LOC106594571 coding downstream 192026 81205128 ~ 81359294 (+)
LOC118938885 LOC106591857 coding downstream 490414 81503516 ~ 81526001 (+)
G1330077 NA non-coding upstream 38101 80973752 ~ 80974428 (+)
G1330048 NA non-coding upstream 58997 80952300 ~ 80953532 (+)
G1330070 NA non-coding upstream 65432 80946145 ~ 80947097 (+)
G1330067 NA non-coding upstream 78856 80932715 ~ 80933673 (+)
G1330090 NA non-coding downstream 8796 81021898 ~ 81022209 (+)
G1330092 NA non-coding downstream 10943 81024045 ~ 81024612 (+)
G1330093 NA non-coding downstream 15524 81028626 ~ 81032689 (+)
G1330046 NA non-coding downstream 22858 81035960 ~ 81037061 (+)
G1330049 NA non-coding downstream 25161 81038263 ~ 81039003 (+)
tbk1 tbk1 other upstream 13719 80970502 ~ 81033922 (+)
G1330026 NA other upstream 153532 80849343 ~ 80869367 (+)
G1329865 NA other upstream 521757 80489848 ~ 80490772 (+)
G1329827 NA other upstream 593270 80418464 ~ 80419259 (+)
G1329273 NA other upstream 1026578 79985593 ~ 79985951 (+)
G1330269 NA other downstream 271299 81284401 ~ 81290964 (+)
G1330422 NA other downstream 388844 81401946 ~ 81402262 (+)

Expression


G1330089 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1330089 Expression in each Bioproject

Bar chart with 19 bars.
G1330089 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network