LOC118939609



Basic Information


Item Value
gene id LOC118939609
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 56437027 ~ 56437100 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005036642.1
TCTTCAGTGATGATTGATACAGTGACTTTCGTTCTTCTGAGTCTACTGAAGCCAACCTTTCTGTCCTGAGAAGA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005036642.1 True 74 mRNA 0.42 1 56437027 56437100
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118939608 NA coding upstream 358 56436596 ~ 56436669 (+)
LOC118939611 NA coding upstream 1374 56435583 ~ 56435653 (+)
prim1 prim1 coding upstream 24634 56400050 ~ 56412393 (+)
LOC110491117 NA coding upstream 114529 56310609 ~ 56322498 (+)
LOC118939557 NA coding upstream 197254 56237795 ~ 56239773 (+)
LOC110492374 ptges3 coding downstream 13815 56450915 ~ 56457720 (+)
LOC110492376 baz2a coding downstream 25405 56462505 ~ 56471950 (+)
LOC110492375 baz2a coding downstream 37310 56474410 ~ 56507995 (+)
LOC118939476 NA coding downstream 87819 56524919 ~ 56526061 (+)
LOC110492377 LOC106566726 coding downstream 99567 56536667 ~ 56540132 (+)
G1391370 NA non-coding upstream 13294 56423421 ~ 56423733 (+)
G1391327 NA non-coding upstream 74966 56360627 ~ 56362061 (+)
G1391318 NA non-coding upstream 84595 56350996 ~ 56352432 (+)
G1391307 NA non-coding upstream 106951 56329859 ~ 56330076 (+)
G1391303 NA non-coding upstream 113367 56323445 ~ 56323660 (+)
G1391363 NA non-coding downstream 20803 56457903 ~ 56459321 (+)
G1391364 NA non-coding downstream 27997 56465097 ~ 56465424 (+)
G1391358 NA non-coding downstream 35195 56472295 ~ 56473635 (+)
G1391382 NA non-coding downstream 54407 56491507 ~ 56491947 (+)
G1391383 NA non-coding downstream 57230 56494330 ~ 56495617 (+)
G1391254 NA other upstream 190154 56246515 ~ 56247620 (+)
G1390616 LOC106566696 other upstream 613835 55793024 ~ 55823192 (+)
G1390527 NA other upstream 796728 55640022 ~ 55640299 (+)
G1390508 NA other upstream 804189 55628694 ~ 55632838 (+)
G1390473 NA other upstream 907379 55528593 ~ 55529648 (+)
LOC118939462 LOC106566730 other downstream 342961 56779988 ~ 56790929 (+)
G1392601 NA other downstream 928851 57365951 ~ 57366517 (+)
G1392616 NA other downstream 959840 57396940 ~ 57397177 (+)
G1392617 NA other downstream 964385 57401485 ~ 57402530 (+)
G1393570 LOC106566761 other downstream 1982286 58419386 ~ 58423502 (+)

Expression


LOC118939609 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network