trnat-agu-123



Basic Information


Item Value
gene id trnat-agu-123
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 71962533 ~ 71962606 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnat-agu-123
ggtgctgtggcttagttggttaaagtgcctgtctagtaaacaggagatcctgagttcaaatctcagcagtacct

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnat-agu-123 True 74 mRNA 0.46 1 71962533 71962606
Loading

Neighbor


gene id symbol gene type direction distance location
trnat-agu-122 NA coding upstream 1303 71961157 ~ 71961230 (+)
trnah-gug-75 NA coding upstream 2320 71960142 ~ 71960213 (+)
trnat-agu-121 NA coding upstream 2675 71959785 ~ 71959858 (+)
trnah-gug-74 NA coding upstream 13648 71948814 ~ 71948885 (+)
trnat-agu-120 NA coding upstream 14004 71948456 ~ 71948529 (+)
trnah-gug-76 NA coding downstream 283 71962889 ~ 71962960 (+)
trnat-agu-137 NA coding downstream 163354 72125960 ~ 72126033 (+)
trnah-gug-90 NA coding downstream 163702 72126308 ~ 72126379 (+)
trnat-agu-138 NA coding downstream 164292 72126898 ~ 72126971 (+)
trnah-gug-91 NA coding downstream 164641 72127247 ~ 72127318 (+)
G1407047 NA non-coding upstream 8 71949328 ~ 71962525 (+)
trnah-gug-53 NA non-coding upstream 40793 71913064 ~ 71921740 (+)
G1407033 NA non-coding upstream 63149 71899063 ~ 71899384 (+)
G1406880 NA non-coding upstream 76447 71885647 ~ 71886086 (+)
G1406876 NA non-coding upstream 83680 71876021 ~ 71878853 (+)
G1407069 NA non-coding downstream 4993 71967599 ~ 71967983 (+)
G1407073 NA non-coding downstream 12025 71974631 ~ 71982206 (+)
G1407079 NA non-coding downstream 24467 71987073 ~ 71988595 (+)
G1407084 NA non-coding downstream 36525 71999131 ~ 72008977 (+)
G1407085 NA non-coding downstream 46524 72009130 ~ 72035634 (+)
G1406555 NA other upstream 546106 71413557 ~ 71416427 (+)
G1406510 NA other upstream 705556 71255979 ~ 71256977 (+)
G1406509 NA other upstream 710889 71251074 ~ 71251644 (+)
G1406508 NA other upstream 716510 71245573 ~ 71246023 (+)
G1406507 NA other upstream 746103 71214377 ~ 71216430 (+)
G1407190 NA other downstream 140780 72103386 ~ 72103841 (+)
G1407199 LOC106566391 other downstream 253707 72216313 ~ 72279555 (+)
ngrn ngrn other downstream 679377 72641881 ~ 72646008 (+)
G1407509 NA other downstream 803296 72765902 ~ 72769218 (+)
LOC110492598 LOC106566362 other downstream 846124 72808730 ~ 72818165 (+)

Expression


trnat-agu-123 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network