LOC118939607



Basic Information


Item Value
gene id LOC118939607
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 78062655 ~ 78062787 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005036640.1
CTGCAGCTTATTAAGCCGTCCAGTCCCGCTGACGTGCGGTTCTGGTGTGCAATGGCTGCAGACAGCAACTCTGTGGTTGTGTATGAGGCCAGCTGGGAGGTGCTGGCCCCTTTAAGGGACCGCTGAGACAACT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005036640.1 True 133 mRNA 0.58 1 78062655 78062787
Loading

Neighbor


gene id symbol gene type direction distance location
haus7 haus7 coding upstream 119826 77928168 ~ 77942829 (+)
LOC110515266 atp2b3 coding upstream 230096 77657611 ~ 77832559 (+)
LOC110519365 NA coding upstream 304252 77754223 ~ 77758403 (+)
LOC110492713 LOC106566291 coding upstream 414113 77611662 ~ 77648542 (+)
LOC110515522 LOC106566305 coding upstream 615579 77347958 ~ 77447742 (+)
LOC118939606 NA coding downstream 2412 78065199 ~ 78065331 (+)
hsd17b10 hsd17b10 coding downstream 85920 78148707 ~ 78167143 (+)
LOC110492717 LOC106593306 coding downstream 425997 78488784 ~ 78511036 (+)
G1411638 NA non-coding upstream 21152 78040860 ~ 78041503 (+)
G1411582 LOC100380643 non-coding upstream 85874 77974834 ~ 77976781 (+)
G1411588 NA non-coding upstream 114553 77947770 ~ 77948102 (+)
G1411587 NA non-coding upstream 115322 77945731 ~ 77947333 (+)
G1411585 NA non-coding upstream 117525 77944233 ~ 77945130 (+)
G1411643 NA non-coding downstream 10968 78073755 ~ 78076913 (+)
G1411651 LOC106572983 non-coding downstream 39464 78102251 ~ 78115591 (+)
G1411659 NA non-coding downstream 53955 78116742 ~ 78120769 (+)
G1411683 NA non-coding downstream 75283 78138070 ~ 78138347 (+)
G1411684 NA non-coding downstream 75733 78138520 ~ 78138730 (+)
G1411161 NA other upstream 568314 77492694 ~ 77494341 (+)
G1410994 NA other upstream 1000561 77061502 ~ 77062094 (+)
G1410829 NA other upstream 1090312 76961443 ~ 76972343 (+)
G1411664 NA other downstream 60523 78123310 ~ 78123962 (+)
G1411988 ccdc115 other downstream 341404 78404191 ~ 78413546 (+)

Expression


LOC118939607 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

LOC118939607 Expression in each Bioproject

Bar chart with 18 bars.
LOC118939607 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network