trnan-guu-13



Basic Information


Item Value
gene id trnan-guu-13
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 78421978 ~ 78422051 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnan-guu-13
gtctctgtggcgcaattggttagcgcgttagactgttaatctaaaggttggtggttcgagcccacccagggacg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnan-guu-13 True 74 mRNA 0.53 1 78421978 78422051
Loading

Neighbor


gene id symbol gene type direction distance location
trnae-uuc-7 NA coding downstream 3089 78418818 ~ 78418889 (-)
ccdc115 ccdc115 coding downstream 7308 78404170 ~ 78414670 (-)
LOC110492722 LOC106566331 coding downstream 40392 78324077 ~ 78381586 (-)
LOC110492720 LOC106573003 coding downstream 107030 78206139 ~ 78314948 (-)
LOC110492727 NA coding downstream 218210 78201885 ~ 78203768 (-)
fkbpl LOC106591935 coding upstream 19580 78441631 ~ 78454461 (-)
G1412145 NA non-coding downstream 60677 78357403 ~ 78361301 (-)
G1412146 NA non-coding downstream 63077 78358500 ~ 78358901 (-)
G1412115 NA non-coding downstream 147901 78273455 ~ 78274077 (-)
G1412110 NA non-coding downstream 157573 78263982 ~ 78264405 (-)
G1412102 NA non-coding downstream 174580 78246162 ~ 78247398 (-)
G1412169 NA non-coding upstream 30292 78452343 ~ 78453268 (-)
G1412193 NA non-coding upstream 34393 78456444 ~ 78456887 (-)
G1412200 NA non-coding upstream 61426 78483477 ~ 78483683 (-)
G1412202 NA non-coding upstream 64710 78486761 ~ 78486961 (-)
G1412091 NA other downstream 102980 78316317 ~ 78318998 (-)
G1411845 rl10 other downstream 354468 78056967 ~ 78067510 (-)
G1411862 NA other downstream 368840 78050266 ~ 78053138 (-)
G1411366 NA other downstream 1070753 77349553 ~ 77351225 (-)
G1411281 NA other downstream 1256155 77165458 ~ 77165823 (-)
G1412203 LOC100136012 other upstream 82240 78504291 ~ 78511632 (-)

Expression


trnan-guu-13 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

trnan-guu-13 Expression in each Bioproject

Bar chart with 1 bar.
trnan-guu-13 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 0.2.
End of interactive chart.

Co-expression Network