G1332512



Basic Information


Item Value
gene id G1332512
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 2248630 ~ 2248913 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1522945
ccagacggggtccttatttgtgggattaaacgtgaggcctcggatttacggatctgatgtgcaaggagtttactggccttgtcgccttgttcatagactttgtatcgagctcgcaagagtaactgttcagcttgcctggtagaaagctcatcaaattcagattggagtagttggcgctctttatgcagatcagaggaaggatccgtagcatacttctcatccaatgtggctatggactcgctcaggtcccgaagtcgctgggagcgaactctgttttggttggc

Function


NR:

description
Retrovirus-related Pol polyprotein LINE-1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1522945 True 284 lncRNA 0.49 1 2248630 2248913
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110491199 i2b2b coding upstream 266289 1978840 ~ 1982341 (+)
tomm20a tomm20 coding upstream 410470 1832028 ~ 1838160 (+)
arid4b arid4b coding upstream 422697 1611744 ~ 1825933 (+)
LOC118939496 NA coding upstream 474036 1771249 ~ 1774594 (+)
LOC118939494 NA coding upstream 690297 1556467 ~ 1558333 (+)
heatr5b LOC106578753 coding downstream 46926 2295839 ~ 2571759 (+)
LOC110535007 LOC106578653 coding downstream 331380 2580293 ~ 2631155 (+)
LOC110491239 LOC106578780 coding downstream 682256 2931169 ~ 2939940 (+)
trnah-gug-6 NA coding downstream 696076 2944989 ~ 2945060 (+)
memo1 LOC106578779 coding downstream 696499 2945412 ~ 2969606 (+)
G1332511 NA non-coding upstream 200 2247429 ~ 2248430 (+)
G1332508 NA non-coding upstream 12595 2235626 ~ 2236035 (+)
G1332486 pkz non-coding upstream 14870 2207482 ~ 2233760 (+)
G1332513 NA non-coding downstream 3336 2252249 ~ 2270730 (+)
G1332520 NA non-coding downstream 4884 2253797 ~ 2258954 (+)
G1332490 NA non-coding downstream 10521 2259434 ~ 2260444 (+)
G1332537 NA non-coding downstream 60805 2309718 ~ 2310072 (+)
G1332538 NA non-coding downstream 72521 2321434 ~ 2322296 (+)
G1332261 NA other upstream 317498 1930754 ~ 1931132 (+)
G1332260 NA other upstream 318157 1929324 ~ 1930473 (+)
G1331652 NA other upstream 809505 1438787 ~ 1439125 (+)
LOC110491220 NA other upstream 1825356 330164 ~ 425574 (+)
G1330834 NA other upstream 1907554 340076 ~ 341076 (+)
G1332701 NA other downstream 723895 2972808 ~ 2973800 (+)
LOC110492796 slx4ip other downstream 816405 3065065 ~ 3201726 (+)
G1332826 NA other downstream 981286 3230199 ~ 3231407 (+)

Expression


G1332512 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1332512 Expression in each Bioproject

Bar chart with 19 bars.
G1332512 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network