G1332935



Basic Information


Item Value
gene id G1332935
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 2338681 ~ 2346735 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1523477
gatattagtatataacaccagctagaacagagagagattagagtatataacaccagctagaacagagagagatgagagtatataacaccagctagaacagagagagatgacagagtatataacaccagctagaacagagagagattagtatataacaccagctagaacagagagagattagtatataacaccagctagaacagagagagattagagtatataacaccagctagaacagagagagattagagtatataacaccagctagaacagagagagattagtatataacaccagctagaacagagagagatgacagagtatataacaccagctagaacagagagagat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1523477 True 351 lncRNA 0.38 2 2338681 2346735
Loading

Neighbor


gene id symbol gene type direction distance location
gpatch11 gpatch11 coding downstream 43778 2289460 ~ 2294903 (-)
eif2ak2 pkr coding downstream 50105 2252487 ~ 2288576 (-)
pkz pkz coding downstream 102742 2198705 ~ 2235939 (-)
LOC118939485 NA coding downstream 187878 2134076 ~ 2150803 (-)
LOC118939484 NA coding downstream 377467 1957128 ~ 1961214 (-)
LOC118939497 NA coding upstream 269053 2615788 ~ 2616529 (-)
vit vit coding upstream 285076 2631811 ~ 2738891 (-)
LOC110492799 LOC106591794 coding upstream 401039 2747774 ~ 2781477 (-)
LOC110491225 LOC106578778 coding upstream 536077 2881255 ~ 2930676 (-)
mkks mkks coding upstream 707425 3054160 ~ 3064816 (-)
G1332929 NA non-coding downstream 21322 2315916 ~ 2317359 (-)
G1332927 NA non-coding downstream 24626 2313344 ~ 2314055 (-)
G1332918 NA non-coding downstream 55394 2282504 ~ 2283287 (-)
G1332882 NA non-coding downstream 90613 2247760 ~ 2248068 (-)
G1332881 NA non-coding downstream 92344 2245635 ~ 2246337 (-)
G1332967 NA non-coding upstream 217854 2564589 ~ 2566769 (-)
G1332965 LOC106578649 non-coding upstream 222345 2569080 ~ 2569453 (-)
G1332970 NA non-coding upstream 230949 2577684 ~ 2578871 (-)
G1332978 NA non-coding upstream 248246 2594981 ~ 2595509 (-)
G1332980 NA non-coding upstream 250175 2596910 ~ 2597466 (-)
G1332878 NA other downstream 110278 2221111 ~ 2228403 (-)
G1332294 i2b2b other downstream 356355 1980673 ~ 1982326 (-)
G1332218 NA other downstream 444512 1893718 ~ 1894169 (-)
G1332206 NA other downstream 473587 1864566 ~ 1865094 (-)
G1332165 LOC100194703 other downstream 529149 1809023 ~ 1809532 (-)
G1333132 NA other upstream 680589 3027324 ~ 3029273 (-)
G1333345 NA other upstream 1100095 3446830 ~ 3522295 (-)
G1334648 NA other upstream 1881449 4228184 ~ 4230047 (-)
G1334697 NA other upstream 1991401 4338136 ~ 4338659 (-)
G1334939 NA other upstream 2538553 4885288 ~ 4886398 (-)

Expression


G1332935 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1332935 Expression in each Bioproject

Bar chart with 13 bars.
G1332935 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network