G1339257



Basic Information


Item Value
gene id G1339257
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 9778391 ~ 9778601 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1531318
ggaaagtggtgttgggggaaaaacatacaacatcataaaatctatgtacacaaacaacaaatgtgtttttaatattgacaaaaaaacacacatttctttccacaggtccatggggtgagacagggatgaagcttaagccccaccctcttcaacatatatatcaatgaataggagagggcactagaacagtctgcaccacccagcctcaccc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1531318 True 211 lncRNA 0.42 1 9778391 9778601
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110491329 LOC106578906 coding downstream 179750 9592672 ~ 9598641 (-)
LOC110491328 LOC106578885 coding downstream 505646 9255867 ~ 9272745 (-)
LOC110491326 narf coding downstream 545393 9209893 ~ 9232998 (-)
mmp25b mmp25 coding downstream 582219 9175791 ~ 9196172 (-)
LOC110491322 LOC106589467 coding downstream 639693 9133541 ~ 9138698 (-)
LOC118939488 NA coding upstream 173162 9951763 ~ 9953398 (-)
LOC110491330 LOC106578899 coding upstream 388898 10167499 ~ 10171071 (-)
LOC118939504 LOC106578899 coding upstream 403295 10181896 ~ 10185879 (-)
LOC110492820 LOC106578899 coding upstream 417091 10195692 ~ 10199662 (-)
LOC118939505 LOC106578899 coding upstream 430875 10209476 ~ 10213292 (-)
G1339256 NA non-coding downstream 549 9777623 ~ 9777842 (-)
G1339255 NA non-coding downstream 2040 9776076 ~ 9776351 (-)
G1339251 NA non-coding downstream 7862 9770211 ~ 9770529 (-)
G1339249 NA non-coding downstream 12434 9765717 ~ 9765957 (-)
G1339247 NA non-coding downstream 16199 9761924 ~ 9762192 (-)
G1339259 NA non-coding upstream 1917 9780518 ~ 9780733 (-)
G1339262 NA non-coding upstream 6015 9784616 ~ 9784829 (-)
G1339264 NA non-coding upstream 10629 9789230 ~ 9789475 (-)
G1339268 NA non-coding upstream 17246 9795847 ~ 9796354 (-)
G1339279 NA non-coding upstream 35664 9814265 ~ 9814548 (-)
G1339219 NA other downstream 74760 9703116 ~ 9703631 (-)
G1338014 NA other downstream 1308247 8467208 ~ 8470144 (-)
G1337783 NA other downstream 1365324 8412771 ~ 8413067 (-)
LOC110492875 LOC106578856 other downstream 1972475 7777876 ~ 7806345 (-)
G1339765 NA other upstream 484673 10263274 ~ 10263742 (-)
G1340519 NA other upstream 1245501 11024102 ~ 11025202 (-)
LOC110491342 LOC106578908 other upstream 1874439 11652429 ~ 11667766 (-)
G1341480 LOC106578921 other upstream 2211643 11946567 ~ 12097768 (-)
G1342941 NA other upstream 2920385 12698986 ~ 12700168 (-)

Expression


G1339257 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1339257 Expression in each Bioproject

Bar chart with 12 bars.
G1339257 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network