G1339268



Basic Information


Item Value
gene id G1339268
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 9795847 ~ 9796354 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1531329
ctgtcgccattcgcctagggctaagcggatgtcgagcagttcgcggtttcccacatcatagttacgttccgacggcgacaggcgatgagaaaaatacgcgcatgggtggaccttgtcgtcagagaaggagcgctgagaaagaatggctcccacgcccacctctgacgcgtcaacctcgacaatgaactgtctagagacgtcaggtgtaacaaggataggtgcggatgtaaaacgattcttgaggagatcaaaagctccctgggcggaaacggaccacttaaagcacgtcttgacagaagtaagggctgtgagaggagctgccacctgaccgaaattacggatgaaacgacgatagaagttcgcaaagccgagaaagcgctgcagctcgacgcgtgacttagggacgggccaatcaatgacagcttggaccttagcgggatccatcttaatgccttcagcggaaataacagaaccgagaaatgtgacggaggaggcatgaaaagagcac

Function


NR:

description
PREDICTED: retrotransposon-like protein 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1531329 True 508 lncRNA 0.53 1 9795847 9796354
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110491329 LOC106578906 coding downstream 197206 9592672 ~ 9598641 (-)
LOC110491328 LOC106578885 coding downstream 523102 9255867 ~ 9272745 (-)
LOC110491326 narf coding downstream 562849 9209893 ~ 9232998 (-)
mmp25b mmp25 coding downstream 599675 9175791 ~ 9196172 (-)
LOC110491322 LOC106589467 coding downstream 657149 9133541 ~ 9138698 (-)
LOC118939488 NA coding upstream 155409 9951763 ~ 9953398 (-)
LOC110491330 LOC106578899 coding upstream 371145 10167499 ~ 10171071 (-)
LOC118939504 LOC106578899 coding upstream 385542 10181896 ~ 10185879 (-)
LOC110492820 LOC106578899 coding upstream 399338 10195692 ~ 10199662 (-)
LOC118939505 LOC106578899 coding upstream 413122 10209476 ~ 10213292 (-)
G1339264 NA non-coding downstream 6372 9789230 ~ 9789475 (-)
G1339262 NA non-coding downstream 11018 9784616 ~ 9784829 (-)
G1339259 NA non-coding downstream 15114 9780518 ~ 9780733 (-)
G1339257 NA non-coding downstream 17246 9778391 ~ 9778601 (-)
G1339256 NA non-coding downstream 18005 9777623 ~ 9777842 (-)
G1339279 NA non-coding upstream 17911 9814265 ~ 9814548 (-)
G1339280 NA non-coding upstream 18416 9814770 ~ 9815560 (-)
G1339388 NA non-coding upstream 33992 9830346 ~ 9830906 (-)
G1339440 NA non-coding upstream 138570 9934924 ~ 9935277 (-)
G1339451 NA non-coding upstream 161753 9958107 ~ 9958431 (-)
G1339219 NA other downstream 92216 9703116 ~ 9703631 (-)
G1338014 NA other downstream 1325703 8467208 ~ 8470144 (-)
G1337783 NA other downstream 1382780 8412771 ~ 8413067 (-)
LOC110492875 LOC106578856 other downstream 1989931 7777876 ~ 7806345 (-)
G1339765 NA other upstream 466920 10263274 ~ 10263742 (-)
G1340519 NA other upstream 1227748 11024102 ~ 11025202 (-)
LOC110491342 LOC106578908 other upstream 1856686 11652429 ~ 11667766 (-)
G1341480 LOC106578921 other upstream 2193890 11946567 ~ 12097768 (-)
G1342941 NA other upstream 2902632 12698986 ~ 12700168 (-)

Expression


G1339268 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1339268 Expression in each Bioproject

Bar chart with 20 bars.
G1339268 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network