G1339649



Basic Information


Item Value
gene id G1339649
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 10284650 ~ 10284964 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1531726
cttgtcgagggcgcacccatctacagggtccgtaggattttggacatgtgtcctcggggccgtggtcatcagtacctagtagattgggaggggtacggtcctgaggagaggagttgggttccctctcgggacgtgctggaccgtgcgctgatcgatgatttcctccgttgccgccaggtttcctcctcgagtgcgccaggaggcgctcggtgagtgggggggtactgtcatgtattgtcatgttgtgtcttgtttctgtcctttcccttcaccctgtctccctctgctggtcgttattaggttaccgtttctccc

Function


NR:

description
PREDICTED: uncharacterized protein LOC109108415

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1531726 True 315 lncRNA 0.57 1 10284650 10284964

Neighbor


gene id symbol gene type direction distance location
llgl2 LOC106578897 coding upstream 13859 10237554 ~ 10270791 (+)
galk1 galk1 coding upstream 47228 10227218 ~ 10237422 (+)
LOC118939487 ogfod3 coding upstream 1028774 9238981 ~ 9255876 (+)
LOC110491327 LOC106578881 coding upstream 1047275 9234025 ~ 9237375 (+)
LOC110491323 NA coding upstream 1113171 9163483 ~ 9171479 (+)
myo15b LOC106578894 coding downstream 4889 10289853 ~ 10320827 (+)
LOC110491336 LOC106578893 coding downstream 45114 10330078 ~ 10373090 (+)
LOC110491338 LOC106589448 coding downstream 93859 10378823 ~ 10407995 (+)
LOC110491340 LOC106578890 coding downstream 284847 10569811 ~ 10572822 (+)
LOC110491343 gna13 coding downstream 1384256 11669220 ~ 11707703 (+)
G1339648 NA non-coding upstream 480 10283866 ~ 10284170 (+)
G1339633 NA non-coding upstream 68386 10215887 ~ 10216264 (+)
G1339626 NA non-coding upstream 85425 10185082 ~ 10199225 (+)
G1339598 NA non-coding upstream 136579 10147863 ~ 10148071 (+)
G1339587 NA non-coding upstream 152881 10131505 ~ 10131769 (+)
G1339660 NA non-coding downstream 19864 10304828 ~ 10305626 (+)
G1339664 NA non-coding downstream 38715 10323679 ~ 10325320 (+)
G1339665 NA non-coding downstream 40901 10325865 ~ 10326410 (+)
G1339675 NA non-coding downstream 59119 10344083 ~ 10382186 (+)
G1339525 NA other upstream 224520 10059878 ~ 10060130 (+)
G1339045 NA other upstream 582270 9701975 ~ 9702380 (+)
G1339018 NA other upstream 658250 9625939 ~ 9626400 (+)
G1338571 NA other upstream 1101477 9178047 ~ 9183173 (+)
LOC110492817 LOC106578874 other upstream 1190286 9091144 ~ 9108207 (+)
G1341172 NA other downstream 1496764 11781728 ~ 11782891 (+)
LOC110492879 NA other downstream 1672562 11952562 ~ 11958858 (+)
G1341689 NA other downstream 1938809 12223773 ~ 12229068 (+)
LOC110491388 LOC106578938 other downstream 2107990 12392917 ~ 12396813 (+)
LOC110491390 LOC106578939 other downstream 2117272 12402185 ~ 12403794 (+)

Expression


G1339649 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1339649 Expression in each Bioproject

Bar chart with 18 bars.
G1339649 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network