G1343288



Basic Information


Item Value
gene id G1343288
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 13280604 ~ 13280981 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1535830
gtacagtcactgtggggacgacgtcctcaatgcacttattgataaagccagtgactgatgtgatgtattcctcaatgtcatcagaagaatcccggaacatgttccagtctgtgatagcaaaacagtcctgtagtttagcatctgcttcatctgaccatttttttatagaccgagtcactgttgcttcctgctttaatttttgcttgtaagcaggaatcaggaggatagagttgtggtcggatttaccaaatggagggcgagggagagctttgtactcgtctctgtgtgtggagtacaggtgatctagaatttcttccctctggttgcacatttaacatgttgatagagatgtggtagaactgatttaattttccctgc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1535830 True 378 lncRNA 0.43 1 13280604 13280981

Neighbor


gene id symbol gene type direction distance location
LOC110491369 LOC106589397 coding downstream 37123 13059005 ~ 13243481 (-)
LOC110491368 LOC106578949 coding downstream 223645 13055138 ~ 13056959 (-)
LOC110492836 LOC106578942 coding downstream 747132 12454370 ~ 12533472 (-)
LOC110511413 NA coding downstream 829971 12449334 ~ 12505933 (-)
LOC110491391 LOC106578936 coding downstream 842197 12422693 ~ 12438407 (-)
LOC110491374 LOC106578955 coding upstream 4640 13285621 ~ 13334372 (-)
LOC110491375 LOC106578956 coding upstream 64205 13345186 ~ 13356029 (-)
rnls rnls coding upstream 140165 13421146 ~ 13464395 (-)
ankrd22 ankrd22 coding upstream 201220 13482201 ~ 13491975 (-)
LOC110491380 acta2 coding upstream 227674 13508655 ~ 13516671 (-)
G1343285 NA non-coding downstream 1902 13278398 ~ 13278702 (-)
G1343283 NA non-coding downstream 18003 13261455 ~ 13262601 (-)
G1343282 NA non-coding downstream 21041 13258519 ~ 13259563 (-)
G1343074 LOC106578947 non-coding downstream 341621 12938488 ~ 12938983 (-)
G1343058 NA non-coding downstream 376190 12903428 ~ 12904414 (-)
G1343289 NA non-coding upstream 184 13281165 ~ 13281366 (-)
G1343095 NA non-coding upstream 3382 13284363 ~ 13284691 (-)
G1343091 NA non-coding upstream 44873 13325854 ~ 13326937 (-)
G1343088 LOC106578953 non-coding upstream 49240 13330221 ~ 13333362 (-)
G1343330 NA non-coding upstream 117623 13398604 ~ 13398840 (-)
G1343278 NA other downstream 28936 13251434 ~ 13251668 (-)
G1342941 NA other downstream 580436 12698986 ~ 12700168 (-)
G1341480 LOC106578921 other downstream 1261090 11946567 ~ 12097768 (-)
LOC110491342 LOC106578908 other downstream 1624041 11652429 ~ 11667766 (-)
G1340519 NA other downstream 2255402 11024102 ~ 11025202 (-)
G1343452 LOC106578962 other upstream 304155 13585136 ~ 13634178 (-)
G1345259 NA other upstream 1970396 15251377 ~ 15253570 (-)
G1345561 NA other upstream 2418004 15698985 ~ 15699263 (-)
G1347067 NA other upstream 3643541 16924522 ~ 16929432 (-)
G1347343 NA other upstream 3914349 17195330 ~ 17196129 (-)

Expression


G1343288 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1343288 Expression in each Bioproject

Bar chart with 20 bars.
G1343288 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network