G1355394 (scn4a)


Basic Information

Item Value
gene id G1355394
gene name scn4a
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 24938788 ~ 24939064 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1549335
CTAACATCTACTTCTAAACTACCCATTTAAAAGTTGTTACCAGGTTCCCCACGGAGAGCATGTGGTCAAACTGTGGGCTCATGGGGTAGTGCTCCATGGCCATGAAGAGGGTGTTGAGCACAATGCAGATGGTGATGCCTAGGTCCACGAAGGGGTCCATCACAATAAAGAGCAACCACTTCTTCAACCATACCCAGGGCACGCAACAGTCCCACTTCAGGAAGATGTCGGCAAACTTGTACCAGCCGGGTGGACAAGGCTTCTGGGCGTCTTCCAG

Function

symbol description
scn4a Enables voltage-gated sodium channel activity. Involved in regulation of skeletal muscle contraction by action potential and sodium ion transmembrane transport. Is integral component of plasma membrane. Part of voltage-gated sodium channel complex. Implicated in congenital myasthenic syndrome 16; hyperkalemic periodic paralysis; and paramyotonia congenita of Von Eulenburg.

NR:

description
sodium channel protein type 4 subunit alpha A-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1549335 True 277 lncRNA 0.52 1 24938788 24939064

Neighbor

gene id symbol gene type direction distance location
ifn5 cd79b coding upstream 46117 24889101 ~ 24897741 (+)
ccr10 LOC106579362 coding upstream 77658 24857512 ~ 24861130 (+)
LOC110491705 ud2a2 coding upstream 109470 24826163 ~ 24829318 (+)
dcakd dcakd coding upstream 155275 24764607 ~ 24783513 (+)
pus3 pus3 coding upstream 181545 24750108 ~ 24759143 (+)
trnaa-ugc-127 NA coding downstream 92265 25031329 ~ 25031399 (+)
mapta NA coding downstream 106628 25045692 ~ 25092985 (+)
LOC110491714 LOC106579122 coding downstream 226322 25165386 ~ 25191533 (+)
zdhhc6 zdhhc6 coding downstream 263357 25202421 ~ 25213711 (+)
gucy2g LOC106579347 coding downstream 391350 25330414 ~ 25367122 (+)
G1355377 NA non-coding upstream 37426 24901051 ~ 24901362 (+)
G1355366 NA non-coding upstream 57695 24880828 ~ 24881093 (+)
G1355357 NA non-coding upstream 66176 24872029 ~ 24872612 (+)
G1355356 NA non-coding upstream 67500 24870960 ~ 24871288 (+)
G1355435 NA non-coding downstream 62575 25001639 ~ 25002613 (+)
G1355443 NA non-coding downstream 71948 25011012 ~ 25011482 (+)
G1355446 NA non-coding downstream 77154 25016218 ~ 25016540 (+)
G1355449 NA non-coding downstream 84690 25023754 ~ 25024012 (+)
G1355498 NA non-coding downstream 175121 25114185 ~ 25114792 (+)
G1355273 NA other upstream 254869 24681414 ~ 24684055 (+)
LOC110491698 LOC106579132 other upstream 257673 24670341 ~ 24681115 (+)
G1354681 rpl19 other upstream 848754 24085708 ~ 24090034 (+)
G1354668 NA other upstream 943767 23993618 ~ 23995021 (+)
znf281b LOC106578343 other downstream 1137477 26076461 ~ 26107407 (+)
mpp3b LOC106579097 other downstream 1365887 26283071 ~ 26314809 (+)
G1358292 NA other downstream 2390247 27329311 ~ 27332275 (+)
LOC110491768 LOC106579066 other downstream 2622083 27561141 ~ 27595350 (+)
LOC110491776 LOC106579398 other downstream 2963986 27902972 ~ 27986259 (+)

Expression


Co-expression Network