G1358725



Basic Information


Item Value
gene id G1358725
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 28103165 ~ 28127485 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1553007
GCTGACACTATGACCGCATCCCCTTCGCTCCACCTCAGTGCAGGGATGTGCTTGAGGCATTGCTTGGAGAGCACGAACAGGCCTGGGAAGAAGACAGACCCGGCAGCCAGGATGGTCAACATGGTCCAACGTGTTTGTCTTGTTGGCAAAGTTCAGCAGGTAGTCTGGTCTTTGAGATCTTTCTTCCCTCTCCACTGTGGAAAGTCCATCTTGGTCCTCTTGATCCATCCACCTGTCTTCTTTGTTTGTCAGGCCTGACCCCTTCATCCCGTAGTTTTTTCCTGTAATCTAATTTAATATGACTGAAGATGCAGAATTTTATGCCAGCCCCCTTCTAAAA

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1553007 True 340 lncRNA 0.49 2 28103165 28127485
Loading

Neighbor


gene id symbol gene type direction distance location
pagr1 pagr1 coding upstream 21794 28049066 ~ 28081371 (+)
LOC110491776 LOC106579398 coding upstream 116906 27902972 ~ 27986259 (+)
LOC110491775 LOC106579060 coding upstream 279584 27776282 ~ 27823581 (+)
LOC110491774 LOC106579062 coding upstream 375369 27703383 ~ 27727796 (+)
sult1st6 LOC106579067 coding upstream 457088 27595428 ~ 27646077 (+)
cabp5a LOC106579440 coding downstream 132798 28260283 ~ 28266022 (+)
nif3l1 nif3l1 coding downstream 151172 28278657 ~ 28287808 (+)
LOC110492866 LOC106521360 coding downstream 451884 28579369 ~ 28607901 (+)
si:ch211-214e3.5 LOC106579413 coding downstream 705879 28833364 ~ 28857801 (+)
nrg3b LOC106579414 coding downstream 797332 28924817 ~ 29353460 (+)
G1358671 NA non-coding upstream 68267 28020384 ~ 28034898 (+)
G1358656 NA non-coding upstream 98641 28002309 ~ 28004524 (+)
G1358619 NA non-coding upstream 157909 27942376 ~ 27945256 (+)
G1358757 NA non-coding downstream 49810 28177295 ~ 28181077 (+)
G1358839 NA non-coding downstream 170784 28298269 ~ 28298893 (+)
G1358944 NA non-coding downstream 346393 28473878 ~ 28474231 (+)
G1358943 NA non-coding downstream 347409 28474894 ~ 28478300 (+)
G1358945 NA non-coding downstream 407833 28535318 ~ 28540660 (+)
G1358698 kif22 other upstream 55775 28046682 ~ 28047390 (+)
LOC110491768 LOC106579066 other upstream 526073 27561141 ~ 27595350 (+)
G1358292 NA other upstream 770890 27329311 ~ 27332275 (+)
mpp3b LOC106579097 other upstream 1788364 26283071 ~ 26314809 (+)
G1361207 NA other downstream 1675169 29802654 ~ 29804368 (+)
G1361671 NA other downstream 1815956 29943441 ~ 29943756 (+)
LOC110492869 LOC106599969 other downstream 2576162 30700999 ~ 30704172 (+)
G1362902 fgfr2 other downstream 2827124 30954609 ~ 30955975 (+)
G1363401 NA other downstream 3107008 31234493 ~ 31235386 (+)

Expression


G1358725 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1358725 Expression in each Bioproject

Bar chart with 17 bars.
G1358725 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network