G1359763



Basic Information


Item Value
gene id G1359763
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 28163463 ~ 28164227 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1554168
gatattaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaatgattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttctgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagatcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1554168 True 765 TUCP 0.41 1 28163463 28164227
Loading

Neighbor


gene id symbol gene type direction distance location
tlcd3bb LOC106579402 coding downstream 34624 28081911 ~ 28128839 (-)
kif22 kif22 coding downstream 114598 28013117 ~ 28048865 (-)
prrt2 LOC106579403 coding downstream 150487 28002303 ~ 28012976 (-)
adprh LOC106579059 coding downstream 321008 27826183 ~ 27842455 (-)
mto1 mto1 coding downstream 408016 27727803 ~ 27755447 (-)
maz maz coding upstream 1120 28165347 ~ 28176911 (-)
taok2b LOC106579406 coding upstream 16018 28177715 ~ 28237354 (-)
eif3c LOC100286610 coding upstream 134026 28298253 ~ 28369344 (-)
si:ch211-180a12.2 LOC106579407 coding upstream 224552 28388779 ~ 28446671 (-)
LOC110491788 LOC106579408 coding upstream 314552 28478779 ~ 28534177 (-)
G1359748 NA non-coding downstream 29836 28133397 ~ 28133627 (-)
G1359717 pagr1 non-coding downstream 90935 28051545 ~ 28072528 (-)
G1359406 NA non-coding downstream 662579 27500155 ~ 27500884 (-)
G1359378 NA non-coding downstream 711466 27451209 ~ 27451997 (-)
G1359771 NA non-coding upstream 12730 28176957 ~ 28177207 (-)
G1359773 NA non-coding upstream 13045 28177272 ~ 28177556 (-)
G1359812 NA non-coding upstream 110539 28274766 ~ 28313407 (-)
G1359899 NA non-coding upstream 305305 28469532 ~ 28469782 (-)
G1359895 NA non-coding upstream 307961 28472188 ~ 28473229 (-)
G1359412 NA other downstream 635326 27527163 ~ 27528137 (-)
G1359321 NA other downstream 803901 27357284 ~ 27359562 (-)
G1359119 NA other downstream 1050062 27111783 ~ 27113401 (-)
LOC110491745 LOC106609103 other downstream 1420008 26729304 ~ 26744821 (-)
G1357833 NA other downstream 1435635 26727295 ~ 26727828 (-)
G1361290 NA other upstream 1332886 29497113 ~ 29497555 (-)
G1361619 NA other upstream 1759644 29923871 ~ 29925154 (-)
G1363836 NA other upstream 3475210 31639437 ~ 31650697 (-)
G1364105 NA other upstream 3721522 31885749 ~ 31886112 (-)

Expression


G1359763 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1359763 Expression in each Bioproject

Bar chart with 20 bars.
G1359763 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network