G1361672



Basic Information


Item Value
gene id G1361672
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 29943334 ~ 29943623 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1556225
gtgggcagctgggaggaggggttcttattctccatggactttacagtgtcccagaacttttttgagttagtgttgcaggaagcaaatttctgcatgaaaaagctagccttggcttttctaactgcctgtgtataatggtttctagcttccctgaacagctgcatatcacgggggctgttcgatgctaatgcagaacgccataggatgtttttttgttggttaagggcagtcaggtctggggagaaccaaggactatatctattcctggttctaaatttcttgaatggggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1556225 True 290 lncRNA 0.46 1 29943334 29943623

Neighbor


gene id symbol gene type direction distance location
LOC110492894 NA coding downstream 69752 29855177 ~ 29873630 (-)
LOC110491798 LOC106578369 coding downstream 240741 29674817 ~ 29702593 (-)
LOC110491794 NA coding downstream 519681 29412470 ~ 29423653 (-)
afap1l2 afap1l2 coding downstream 1176332 28626132 ~ 28767002 (-)
LOC110491790 LOC100194624 coding downstream 1402689 28535317 ~ 28540645 (-)
LOC110492868 LOC106579432 coding upstream 11983 29955527 ~ 30543872 (-)
LOC110491806 LOC106579428 coding upstream 980982 30924605 ~ 31019315 (-)
LOC110492870 ate1 coding upstream 1186494 31130117 ~ 31182991 (-)
LOC110491809 p5cs coding upstream 1326986 31270609 ~ 31285633 (-)
LOC110491810 LOC106579441 coding upstream 1361460 31305083 ~ 31307541 (-)
G1361665 NA non-coding downstream 5405 29937314 ~ 29937929 (-)
G1361658 NA non-coding downstream 13289 29929845 ~ 29930045 (-)
G1361657 NA non-coding downstream 15159 29927872 ~ 29928175 (-)
G1361620 if3ei non-coding downstream 34787 29907345 ~ 29908547 (-)
G1361645 NA non-coding downstream 39230 29903881 ~ 29904104 (-)
G1361674 NA non-coding upstream 827 29944450 ~ 29944890 (-)
G1361676 NA non-coding upstream 1376 29944999 ~ 29945211 (-)
G1361681 NA non-coding upstream 5963 29949586 ~ 29949797 (-)
G1362120 NA non-coding upstream 19818 29963441 ~ 29963667 (-)
G1361619 NA other downstream 18180 29923871 ~ 29925154 (-)
G1361290 NA other downstream 445779 29497113 ~ 29497555 (-)
taok2b LOC106579406 other downstream 1762394 28177715 ~ 28237354 (-)
G1359763 NA other downstream 1779107 28163463 ~ 28164227 (-)
G1359412 NA other downstream 2415197 27527163 ~ 27528137 (-)
G1363836 NA other upstream 1695814 31639437 ~ 31650697 (-)
G1364105 NA other upstream 1942126 31885749 ~ 31886112 (-)
G1364348 NA other upstream 2075171 32018794 ~ 32019498 (-)
G1365099 NA other upstream 2690842 32634465 ~ 32635511 (-)
G1366703 NA other upstream 3740388 33684011 ~ 33684473 (-)

Expression


G1361672 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1361672 Expression in each Bioproject

Bar chart with 17 bars.
G1361672 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network