G1364105



Basic Information


Item Value
gene id G1364105
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 31885749 ~ 31886112 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1558829
AAAATGTTGACAGCTGGAGTGATCGAAGAGTCACATAGTGAGTGGTCTAGCCCAATTGTGATGGTCTCCAAGCCCGATGGGTCTTTGCGGTTCTGTAACGACTTTCGGAAGGTAAATGAAATCTCCAAGTTTGATGCCTACCCCATGCCCCGAGTAGATGAACTACTGGAGAAAATTGGTAATGCTCGGTACATTACGACCCTTGATCTGACAAAAGGGTACTGGCAAATTCCTCTGACCCCCAGGGCCAAAGAAAAGACAGCCTTTGCAAAACCTGACGGTTTGTTTCAATACACCGTCATGCCATTCGGCTTACACGGGGCCCCAGCCACCTTTCAACGGCTCATGGACAAAGTCCTAAAAC

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1558829 True 364 TUCP 0.48 1 31885749 31886112
Loading

Neighbor


gene id symbol gene type direction distance location
si:ch211-28p3.4 LOC106579421 coding downstream 156806 31712301 ~ 31728943 (-)
LOC110491813 LOC106579422 coding downstream 389449 31474791 ~ 31496300 (-)
LOC110491807 LOC106576884 coding downstream 423504 31314091 ~ 31462245 (-)
LOC110491810 LOC106579441 coding downstream 578208 31305083 ~ 31307541 (-)
LOC110491809 p5cs coding downstream 600116 31270609 ~ 31285633 (-)
ttc34 ttc34 coding upstream 64407 31950519 ~ 31958002 (-)
LOC110491820 LOC106567387 coding upstream 80610 31966722 ~ 31989796 (-)
LOC110491822 LOC106567384 coding upstream 170836 32056948 ~ 32096133 (-)
LOC110491823 NA coding upstream 195595 32081707 ~ 32086786 (-)
LOC110491825 LOC100380856 coding upstream 344175 32230287 ~ 32350853 (-)
G1364104 NA non-coding downstream 1048 31884337 ~ 31884701 (-)
G1364100 NA non-coding downstream 4358 31881018 ~ 31881391 (-)
G1364087 NA non-coding downstream 5443 31846120 ~ 31880306 (-)
G1364088 NA non-coding downstream 15176 31868365 ~ 31870573 (-)
G1364093 NA non-coding downstream 16354 31866360 ~ 31869395 (-)
G1364116 NA non-coding upstream 389 31886501 ~ 31893966 (-)
G1364118 NA non-coding upstream 13728 31899840 ~ 31903310 (-)
G1364117 NA non-coding upstream 15382 31901494 ~ 31907490 (-)
G1364123 NA non-coding upstream 26979 31913091 ~ 31919360 (-)
G1364124 NA non-coding upstream 34784 31920896 ~ 31922383 (-)
G1363836 NA other downstream 235052 31639437 ~ 31650697 (-)
G1361619 NA other downstream 1960595 29923871 ~ 29925154 (-)
G1361290 NA other downstream 2388194 29497113 ~ 29497555 (-)
taok2b LOC106579406 other downstream 3704809 28177715 ~ 28237354 (-)
G1359763 NA other downstream 3721522 28163463 ~ 28164227 (-)
G1364348 NA other upstream 132682 32018794 ~ 32019498 (-)
G1365099 NA other upstream 748353 32634465 ~ 32635511 (-)
G1366703 NA other upstream 1797899 33684011 ~ 33684473 (-)
G1366756 NA other upstream 1861288 33747400 ~ 33751407 (-)
LOC110491043 NA other upstream 1977394 33863087 ~ 33870055 (-)

Expression


G1364105 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1364105 Expression in each Bioproject

Bar chart with 19 bars.
G1364105 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network