G1364348



Basic Information


Item Value
gene id G1364348
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 32018794 ~ 32019498 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1559113
ctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacatgcactgtgaaagtctcagaggtctgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaggatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccataatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctagcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgtcgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1559113 True 705 TUCP 0.43 1 32018794 32019498

Neighbor


gene id symbol gene type direction distance location
LOC110491820 LOC106567387 coding downstream 28998 31966722 ~ 31989796 (-)
ttc34 ttc34 coding downstream 60792 31950519 ~ 31958002 (-)
si:ch211-28p3.4 LOC106579421 coding downstream 289851 31712301 ~ 31728943 (-)
LOC110491813 LOC106579422 coding downstream 522494 31474791 ~ 31496300 (-)
LOC110491807 LOC106576884 coding downstream 556549 31314091 ~ 31462245 (-)
LOC110491822 LOC106567384 coding upstream 37450 32056948 ~ 32096133 (-)
LOC110491823 NA coding upstream 62209 32081707 ~ 32086786 (-)
LOC110491825 LOC100380856 coding upstream 210789 32230287 ~ 32350853 (-)
pigt LOC106567380 coding upstream 416729 32436227 ~ 32466311 (-)
LOC110491830 LOC106567378 coding upstream 599250 32618748 ~ 32628980 (-)
G1364347 LOC106581475 non-coding downstream 1147 32017413 ~ 32017647 (-)
G1364313 NA non-coding downstream 72238 31946321 ~ 31946556 (-)
G1364124 NA non-coding downstream 96411 31920896 ~ 31922383 (-)
G1364123 NA non-coding downstream 99434 31913091 ~ 31919360 (-)
G1364117 NA non-coding downstream 111304 31901494 ~ 31907490 (-)
G1364357 NA non-coding upstream 12396 32031894 ~ 32032230 (-)
G1364358 NA non-coding upstream 12853 32032351 ~ 32032690 (-)
G1364366 NA non-coding upstream 25093 32044591 ~ 32045093 (-)
G1364341 NA non-coding upstream 35111 32054609 ~ 32056554 (-)
G1364424 NA non-coding upstream 119640 32139138 ~ 32191970 (-)
G1364105 NA other downstream 132682 31885749 ~ 31886112 (-)
G1363836 NA other downstream 368097 31639437 ~ 31650697 (-)
G1361619 NA other downstream 2093640 29923871 ~ 29925154 (-)
G1361290 NA other downstream 2521239 29497113 ~ 29497555 (-)
taok2b LOC106579406 other downstream 3837854 28177715 ~ 28237354 (-)
G1365099 NA other upstream 614967 32634465 ~ 32635511 (-)
G1366703 NA other upstream 1664513 33684011 ~ 33684473 (-)
G1366756 NA other upstream 1727902 33747400 ~ 33751407 (-)
LOC110491043 NA other upstream 1844008 33863087 ~ 33870055 (-)
LOC110491862 tnfrsf6b other upstream 3058603 35077807 ~ 35079706 (-)

Expression


G1364348 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1364348 Expression in each Bioproject

Bar chart with 20 bars.
G1364348 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network