G1364937 (LOC106613263)



Basic Information


Item Value
gene id G1364937
gene name LOC106613263
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 32669696 ~ 32670131 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1559734
ggccaaccgcaccagcatatggggtctgaggatctcatctcggtagcgaatggcagtcaggctacctctggcgagcacatggagggctgtgcggccccccaaagaaatgccaccgcacaccatgactgacccaccgccaaaccggtcatgctggaggatgttgcaggcagcagaacgttctccacggcgtctccagactgtcacatctgtcacgtgtgctcagtgtgaacctgctttcatctgtgaagagcacagggcgccagtggcgactttgccaatcttggtgttctctggcaaatgccaaacgtcctgcacggtgttgggctgtaagcacaacccccacctgtggacgtcgtgccctcataccaccctcatggtgtccgtttctgactgtttgagcagacacatgcacatttgtggcctgctggaggtcatt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1559734 True 436 TUCP 0.57 1 32669696 32670131

Neighbor


gene id symbol gene type direction distance location
phactr3a LOC106567379 coding upstream 127845 32481622 ~ 32541851 (+)
LOC110491827 LOC106567381 coding upstream 237472 32430547 ~ 32432224 (+)
LOC110491824 LOC106572151 coding upstream 445770 32204475 ~ 32223926 (+)
LOC118939457 NA coding upstream 467543 32183913 ~ 32202153 (+)
znf362b LOC106572154 coding upstream 660260 32000497 ~ 32009436 (+)
LOC110491833 LOC106567375 coding downstream 146392 32816523 ~ 32914249 (+)
LOC110491835 LOC106572137 coding downstream 308112 32978243 ~ 33082112 (+)
LOC110491836 LOC106567372 coding downstream 344810 33014941 ~ 33038394 (+)
foxl2l LOC100136213 coding downstream 681465 33351596 ~ 33352486 (+)
kiaa2013 LOC106567369 coding downstream 875266 33545397 ~ 33560774 (+)
G1364932 NA non-coding upstream 8072 32661365 ~ 32661624 (+)
G1364930 NA non-coding upstream 10170 32659310 ~ 32659526 (+)
G1364898 NA non-coding upstream 73340 32596122 ~ 32596356 (+)
G1364819 NA non-coding upstream 153796 32472302 ~ 32515900 (+)
G1364811 LOC106567380 non-coding upstream 203428 32462123 ~ 32466268 (+)
G1364939 NA non-coding downstream 3682 32673813 ~ 32674104 (+)
G1364956 NA non-coding downstream 27578 32697709 ~ 32697933 (+)
G1364957 NA non-coding downstream 27912 32698043 ~ 32698274 (+)
G1364958 NA non-coding downstream 28760 32698891 ~ 32699102 (+)
G1364960 NA non-coding downstream 30144 32700275 ~ 32708162 (+)
G1364907 NA other upstream 62563 32606790 ~ 32607133 (+)
G1364768 NA other upstream 267888 32401434 ~ 32401808 (+)
G1363401 NA other upstream 1434310 31234493 ~ 31235386 (+)
G1362902 fgfr2 other upstream 1713721 30954609 ~ 30955975 (+)
LOC110492869 LOC106599969 other upstream 1965588 30700999 ~ 30704172 (+)
G1366438 NA other downstream 1043102 33713233 ~ 33713620 (+)
LOC110491848 morn1 other downstream 1447350 34073929 ~ 34154670 (+)
si:ch73-70k4.1 faap20 other downstream 1764254 34434347 ~ 34441463 (+)
G1368422 NA other downstream 3072619 35706331 ~ 35779587 (+)
G1368473 yo84 other downstream 3162160 35832291 ~ 35832708 (+)

Expression


G1364937(LOC106613263) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1364937(LOC106613263) Expression in each Bioproject

Bar chart with 17 bars.
G1364937(LOC106613263) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network