G1366761



Basic Information


Item Value
gene id G1366761
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 33761267 ~ 33761596 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1561659
ctggaaacacttatctccctcactagctttaagcaccaactgtcagagcagctcacagattactgcacctgtacatagcccacctataatttagcccaaacaactacctctttccctactgtatttaatttatttatttattttgctcctttgcaccccattatttctatttctactttgcacattcttccattgcaaatctaccattccagtgttttacttgctatattgtatttactttgccaccatgacctttttgcctttacctcccttctcacctcatttgctcacatcgtataaagacttgtttatactgtattattgactgta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1561659 True 330 lncRNA 0.37 1 33761267 33761596
Loading

Neighbor


gene id symbol gene type direction distance location
clcn6 clcn6 coding downstream 80024 33652657 ~ 33681243 (-)
LOC118939523 NA coding downstream 229920 33484120 ~ 33531347 (-)
LOC110491041 LOC106572132 coding downstream 277431 33419422 ~ 33483836 (-)
LOC118939522 LOC106572132 coding downstream 344772 33371376 ~ 33416495 (-)
LOC110491838 LOC106567371 coding downstream 565791 33193536 ~ 33195476 (-)
LOC110491843 LOC106567362 coding upstream 10729 33772325 ~ 33862653 (-)
LOC110491043 NA coding upstream 101491 33863087 ~ 33870055 (-)
skia ski coding upstream 586333 34347929 ~ 34429211 (-)
LOC110491852 prkcz coding upstream 692471 34454067 ~ 34596158 (-)
LOC110491856 LOC106566938 coding upstream 1009230 34770826 ~ 34796155 (-)
G1366760 NA non-coding downstream 994 33760039 ~ 33760273 (-)
G1366759 NA non-coding downstream 1360 33759473 ~ 33759907 (-)
G1366758 NA non-coding downstream 4702 33756231 ~ 33756565 (-)
G1366757 NA non-coding downstream 5306 33755758 ~ 33755961 (-)
G1366725 NA non-coding downstream 53879 33707188 ~ 33707388 (-)
G1366762 NA non-coding upstream 1861 33763457 ~ 33763751 (-)
G1366765 NA non-coding upstream 4272 33765868 ~ 33766103 (-)
G1366861 NA non-coding upstream 153661 33915257 ~ 33915565 (-)
G1366863 NA non-coding upstream 155455 33917051 ~ 33917355 (-)
G1366756 NA other downstream 9860 33747400 ~ 33751407 (-)
G1366703 NA other downstream 76794 33684011 ~ 33684473 (-)
G1365099 NA other downstream 1125756 32634465 ~ 32635511 (-)
G1364348 NA other downstream 1741769 32018794 ~ 32019498 (-)
G1364105 NA other downstream 1875155 31885749 ~ 31886112 (-)
LOC110491862 tnfrsf6b other upstream 1316505 35077807 ~ 35079706 (-)
G1369101 NA other upstream 1986380 35747976 ~ 35780436 (-)
G1369107 NA other upstream 1987261 35748857 ~ 35752941 (-)
LOC110491868 LOC106566949 other upstream 2041472 35474174 ~ 35994010 (-)

Expression


G1366761 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1366761 Expression in each Bioproject

Bar chart with 20 bars.
G1366761 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network