G1367060



Basic Information


Item Value
gene id G1367060
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 34183399 ~ 34183796 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1562001
acctgagactgaaaagatttggcataggcccacagatcctcaaaaggttctacagctgcaccatcgagagcatcctgaccggttgcatcaccgcctggtatggaaactgctcggcatctgactgtaaggctctacagaggatagtgcaaacggcccagtacattactggggccaagcttcctgccatccaggacctatataataggcggtgtcagaggaaagcccataaaattgtcagactccccagccacccaagttatagactcttttctctgccaccacacggcaagcggtaccggagcgccaagtctaggaccaaaaggctcctcaacagcttctacccccaagccatatgattgctgaacaattcataaaaatcgccaccggacaatttacat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1562001 True 398 lncRNA 0.51 1 34183399 34183796
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110491848 morn1 coding upstream 28729 34073929 ~ 34154670 (+)
si:ch211-251b21.1 LOC106567361 coding upstream 119395 34055773 ~ 34064004 (+)
plch2a LOC106572832 coding upstream 132453 33866678 ~ 34050946 (+)
LOC110491844 LOC106567364 coding upstream 349431 33805531 ~ 33833968 (+)
LOC110491842 mthfr coding upstream 435516 33721265 ~ 33747883 (+)
si:ch73-70k4.1 faap20 coding downstream 250551 34434347 ~ 34441463 (+)
LOC110491853 LOC106567354 coding downstream 462750 34646546 ~ 34663067 (+)
LOC110491854 LOC106567355 coding downstream 479402 34663198 ~ 34671581 (+)
LOC110491855 LOC106566937 coding downstream 527855 34711651 ~ 34757113 (+)
LOC110491857 LOC106566940 coding downstream 626386 34810182 ~ 34830816 (+)
G1367056 NA non-coding upstream 4025 34178927 ~ 34179374 (+)
G1367055 NA non-coding upstream 4685 34178505 ~ 34178714 (+)
G1367041 NA non-coding upstream 12861 34170244 ~ 34170538 (+)
G1366594 NA non-coding upstream 151280 34031670 ~ 34032119 (+)
G1366562 NA non-coding upstream 218060 33965133 ~ 33965339 (+)
G1367070 NA non-coding downstream 9213 34193009 ~ 34193377 (+)
G1367106 NA non-coding downstream 40339 34224135 ~ 34224354 (+)
G1367108 NA non-coding downstream 43198 34226994 ~ 34227516 (+)
G1367126 NA non-coding downstream 56059 34239855 ~ 34240080 (+)
G1367138 NA non-coding downstream 63518 34247314 ~ 34249889 (+)
G1366438 NA other upstream 469779 33713233 ~ 33713620 (+)
G1364937 LOC106613263 other upstream 1513268 32669696 ~ 32670131 (+)
G1364907 NA other upstream 1576266 32606790 ~ 32607133 (+)
G1364768 NA other upstream 1781591 32401434 ~ 32401808 (+)
G1368422 NA other downstream 1558954 35706331 ~ 35779587 (+)
G1368473 yo84 other downstream 1648495 35832291 ~ 35832708 (+)
LOC110491910 LOC108432721 other downstream 4230061 38390387 ~ 38416472 (+)
G1372263 NA other downstream 5437578 39621374 ~ 39621885 (+)

Expression


G1367060 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1367060 Expression in each Bioproject

Bar chart with 20 bars.
G1367060 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network