G1370198



Basic Information


Item Value
gene id G1370198
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 36962746 ~ 36963071 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1565458
cacgttgcaccacagactgtccaggagttgacggatgctttagtccaggtctgggaggagatccctcaggagaccatccgccacctcatcaggagcatgcccaggcattgtagggaggtcatacaggcacgtggaggccacacacactactgagcctcattttgacttgttttaatgaccttacatcaaagttggatcagcctgtagtgtggttttccaatttaattttgagtgtgactccaaatccagacctccatgggttgataaatgtgatttccattgatcatttttgtgtgattttgttgtcagcacattcaactatgtaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1565458 True 326 lncRNA 0.46 1 36962746 36963071
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110491877 NA coding downstream 600524 36351765 ~ 36362222 (-)
LOC110491872 LOC106566950 coding downstream 885048 36071627 ~ 36077698 (-)
LOC110491868 LOC106566949 coding downstream 968736 35474174 ~ 35994010 (-)
LOC110491870 NA coding downstream 977246 35979860 ~ 35985500 (-)
LOC110491867 NA coding downstream 1592616 35368011 ~ 35370130 (-)
LOC110492897 LOC106567319 coding upstream 73791 37036862 ~ 37038267 (-)
LOC110492898 LOC106567320 coding upstream 83628 37046699 ~ 37048117 (-)
LOC100305135 LOC100305135 coding upstream 255725 37218796 ~ 37228315 (-)
LOC110491882 LOC106572212 coding upstream 337794 37300865 ~ 37302929 (-)
LOC118939528 NA coding upstream 634615 37597686 ~ 37604276 (-)
G1370196 NA non-coding downstream 4720 36957661 ~ 36958026 (-)
G1370195 NA non-coding downstream 5133 36957302 ~ 36957613 (-)
G1370171 NA non-coding downstream 16333 36945867 ~ 36946413 (-)
G1370188 NA non-coding downstream 21726 36940661 ~ 36941020 (-)
G1370186 NA non-coding downstream 25058 36936964 ~ 36937688 (-)
G1370207 NA non-coding upstream 8726 36971797 ~ 36972023 (-)
G1370208 NA non-coding upstream 13098 36976169 ~ 36976532 (-)
G1370210 NA non-coding upstream 14053 36977124 ~ 36977333 (-)
G1370472 NA non-coding upstream 122660 37085731 ~ 37112031 (-)
G1370491 NA non-coding upstream 151297 37114368 ~ 37114601 (-)
G1369101 NA other downstream 1182310 35747976 ~ 35780436 (-)
G1369107 NA other downstream 1209805 35748857 ~ 35752941 (-)
LOC110491862 tnfrsf6b other downstream 1883141 35077807 ~ 35079706 (-)
LOC110491043 NA other downstream 3092848 33863087 ~ 33870055 (-)
G1370601 LOC106566960 other upstream 314574 37277645 ~ 37278677 (-)
G1370826 NA other upstream 697618 37660689 ~ 37661465 (-)
G1371532 NA other upstream 1320337 38283408 ~ 38284066 (-)
G1372845 LOC106566999 other upstream 1808557 38771628 ~ 38772877 (-)
G1372979 NA other upstream 2028521 38991592 ~ 38992220 (-)

Expression


G1370198 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1370198 Expression in each Bioproject

Bar chart with 13 bars.
G1370198 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network