G1370491



Basic Information


Item Value
gene id G1370491
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 37114368 ~ 37114601 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1565771
TAGTTGGACAGGGTGCTGGAGGGCGAGCCCATGTCGAAGTGGGCCGGTTGCTGGGTCTGCCGCGACCCCGCTGGGGACATCGTGTTGTTGGGGGATGACAGGCCCATGTCGGGCTGCTTGCTGTACTCCAGGTCGGCCGATGGGTCCCTGGAAAGCACGCGGTGCGCCACACTCTGGATAAGACAACCACAACGAGGGGTTAACAAAACAAGGTCATCCAGGAACCTAAGGGAA

Function


NR:

description
espin-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1565771 True 234 lncRNA 0.61 1 37114368 37114601
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110492898 LOC106567320 coding downstream 66251 37046699 ~ 37048117 (-)
LOC110492897 LOC106567319 coding downstream 76101 37036862 ~ 37038267 (-)
LOC110491877 NA coding downstream 752146 36351765 ~ 36362222 (-)
LOC110491872 LOC106566950 coding downstream 1036670 36071627 ~ 36077698 (-)
LOC110491870 NA coding downstream 1128868 35979860 ~ 35985500 (-)
LOC100305135 LOC100305135 coding upstream 104195 37218796 ~ 37228315 (-)
LOC110491882 LOC106572212 coding upstream 186264 37300865 ~ 37302929 (-)
LOC118939528 NA coding upstream 483085 37597686 ~ 37604276 (-)
LOC110491896 LOC106566965 coding upstream 508232 37622833 ~ 37634876 (-)
LOC118939599 NA coding upstream 568918 37683519 ~ 37683637 (-)
G1370472 NA non-coding downstream 2337 37085731 ~ 37112031 (-)
G1370210 NA non-coding downstream 137035 36977124 ~ 36977333 (-)
G1370208 NA non-coding downstream 137836 36976169 ~ 36976532 (-)
G1370207 NA non-coding downstream 142345 36971797 ~ 36972023 (-)
G1370198 NA non-coding downstream 151297 36962746 ~ 36963071 (-)
G1370529 NA non-coding upstream 47956 37162557 ~ 37164019 (-)
G1370550 NA non-coding upstream 81632 37196233 ~ 37196670 (-)
G1370551 NA non-coding upstream 82439 37197040 ~ 37197457 (-)
G1370552 NA non-coding upstream 83194 37197795 ~ 37198067 (-)
G1370554 NA non-coding upstream 85212 37199813 ~ 37200125 (-)
LOC110491868 LOC106566949 other downstream 1120897 35474174 ~ 35994010 (-)
G1369101 NA other downstream 1333932 35747976 ~ 35780436 (-)
G1369107 NA other downstream 1361427 35748857 ~ 35752941 (-)
LOC110491862 tnfrsf6b other downstream 2034763 35077807 ~ 35079706 (-)
LOC110491043 NA other downstream 3244470 33863087 ~ 33870055 (-)
G1370601 LOC106566960 other upstream 163044 37277645 ~ 37278677 (-)
G1370826 NA other upstream 546088 37660689 ~ 37661465 (-)
G1371532 NA other upstream 1168807 38283408 ~ 38284066 (-)
G1372845 LOC106566999 other upstream 1657027 38771628 ~ 38772877 (-)
G1372979 NA other upstream 1876991 38991592 ~ 38992220 (-)

Expression


G1370491 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G1370491 Expression in each Bioproject

Bar chart with 1 bar.
G1370491 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network