G1373199



Basic Information


Item Value
gene id G1373199
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 39421837 ~ 39422079 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1568801
cttatatataggtgtgtgcctttccaaatcatgtccaatcaattgaatttaccacaggtggactctaatcaagatgtagaaacatctcaaggatgataacaggatgcatctgagctcaatttcgagtctcatagcaaatggtctgaatacttgtgtaaataaggtatttatgttgtaaagtttctatacatttgcaaacatttctaataacctgttgtcactttgtcattatgggttactgtg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1568801 True 243 lncRNA 0.35 1 39421837 39422079

Neighbor


gene id symbol gene type direction distance location
LOC110491935 LOC106567011 coding downstream 88155 39309981 ~ 39333682 (-)
LOC110492900 NA coding downstream 202203 39218685 ~ 39219634 (-)
LOC110491931 LOC106567008 coding downstream 203655 39213698 ~ 39218182 (-)
LOC118939532 NA coding downstream 273992 39124872 ~ 39147845 (-)
si:dkey-157g16.6 LOC106567002 coding downstream 377934 39013363 ~ 39043903 (-)
zgc:158263 LOC106567014 coding upstream 129638 39551717 ~ 39563244 (-)
LOC110491945 LOC106567025 coding upstream 305834 39727913 ~ 39732807 (-)
LOC110491943 LOC106567023 coding upstream 311365 39733444 ~ 39751919 (-)
LOC110491953 NA coding upstream 539545 39961624 ~ 39992363 (-)
ribc1 ribc1 coding upstream 631230 40053309 ~ 40064572 (-)
G1373197 NA non-coding downstream 1985 39419593 ~ 39419852 (-)
G1373195 NA non-coding downstream 3577 39417885 ~ 39418260 (-)
G1373191 NA non-coding downstream 10734 39410884 ~ 39411103 (-)
G1373185 NA non-coding downstream 19694 39401917 ~ 39402143 (-)
G1373138 NA non-coding downstream 42087 39321041 ~ 39379750 (-)
G1373201 NA non-coding upstream 3717 39425796 ~ 39426462 (-)
G1373251 NA non-coding upstream 59913 39481992 ~ 39482752 (-)
G1373271 NA non-coding upstream 84933 39507012 ~ 39507296 (-)
G1373303 NA non-coding upstream 154876 39576955 ~ 39577272 (-)
G1373304 NA non-coding upstream 156300 39578379 ~ 39578595 (-)
G1372979 NA other downstream 429617 38991592 ~ 38992220 (-)
G1372845 LOC106566999 other downstream 648960 38771628 ~ 38772877 (-)
G1371532 NA other downstream 1137771 38283408 ~ 38284066 (-)
G1370826 NA other downstream 1760372 37660689 ~ 37661465 (-)
G1373200 NA other upstream 71 39422150 ~ 39422852 (-)
G1373226 LOC100380735 other upstream 107845 39529924 ~ 39535299 (-)
G1373378 NA other upstream 297785 39719864 ~ 39720977 (-)
G1373490 LOC100380641 other upstream 518143 39940222 ~ 39943028 (-)
LOC110491948 LOC106567031 other upstream 660378 40080690 ~ 40119070 (-)

Expression


G1373199 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1373199 Expression in each Bioproject

Bar chart with 11 bars.
G1373199 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network