G1374850



Basic Information


Item Value
gene id G1374850
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 41456386 ~ 41456611 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1570632
GCATAGACAAGCGCTACAAACCTGCCAATGGAGTGTTATCTGAGAATACTAGTCGAATTAGCATGACATACTACAATGCCGCAGCACAATTTGCCACTCAGACGTTACTTGATGCAACCCAGACGTTATTTGATCCAGCGTCAGCAGTGACAGATTTCATAGAGAATCTGAGGCCAGTGAGCCTCGGATCCTAAATAGAACGAGAAATAAACATGTCGAATTGGAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1570632 True 226 lncRNA 0.44 1 41456386 41456611
Loading

Neighbor


gene id symbol gene type direction distance location
calcoco1a LOC106572538 coding downstream 60718 41385586 ~ 41395668 (-)
LOC110491987 LOC106567064 coding downstream 177389 41262830 ~ 41278997 (-)
mfsd5 mfsd5 coding downstream 202603 41249937 ~ 41253783 (-)
LOC110491989 LOC106567063 coding downstream 208347 41242965 ~ 41248039 (-)
LOC110491986 LOC106567061 coding downstream 216076 41230602 ~ 41240310 (-)
cbx5 LOC106567067 coding upstream 181226 41637837 ~ 41645221 (-)
nfe2 LOC106567066 coding upstream 192586 41649197 ~ 41657737 (-)
znf740b LOC106567069 coding upstream 231635 41688246 ~ 41697155 (-)
zgc:174906 LOC106567072 coding upstream 243784 41700395 ~ 41704276 (-)
spryd3 LOC106567075 coding upstream 274581 41729589 ~ 41814584 (-)
G1374790 NA non-coding downstream 56232 41363933 ~ 41400154 (-)
G1374755 NA non-coding downstream 137734 41317180 ~ 41318652 (-)
G1374704 NA non-coding downstream 197011 41257403 ~ 41259375 (-)
G1374672 NA non-coding downstream 214600 41185859 ~ 41241786 (-)
G1374671 NA non-coding downstream 215214 41184380 ~ 41241172 (-)
G1375395 NA non-coding upstream 25266 41481877 ~ 41482286 (-)
G1375396 hoxc10aa non-coding upstream 32391 41489002 ~ 41494077 (-)
G1375479 NA non-coding upstream 153506 41610117 ~ 41610357 (-)
G1375541 NA non-coding upstream 381815 41838426 ~ 41841200 (-)
G1374491 LOC106567058 other downstream 426980 41026775 ~ 41029406 (-)
rps26 LOC106567051 other downstream 601797 40852758 ~ 40854671 (-)
G1374237 LOC106567042 other downstream 931108 40522997 ~ 40525278 (-)
LOC110491948 LOC106567031 other downstream 1371560 40080690 ~ 40119070 (-)
G1373490 LOC100380641 other downstream 1513358 39940222 ~ 39943028 (-)
G1375495 NA other upstream 207137 41663748 ~ 41664049 (-)
LOC110492013 LOC106567078 other upstream 398169 41852627 ~ 41857489 (-)
LOC110492054 LOC106567113 other upstream 1096948 42548642 ~ 42569532 (-)
LOC110492059 LOC106567118 other upstream 1315695 42767849 ~ 42773348 (-)
LOC110491060 LOC106567122 other upstream 1662277 43117471 ~ 43124619 (-)

Expression


G1374850 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1374850 Expression in each Bioproject

Bar chart with 1 bar.
G1374850 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network