G1375495



Basic Information


Item Value
gene id G1375495
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 41663748 ~ 41664049 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1571388
tttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactatcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1571388 True 302 TUCP 0.45 1 41663748 41664049

Neighbor


gene id symbol gene type direction distance location
nfe2 LOC106567066 coding downstream 6011 41649197 ~ 41657737 (-)
cbx5 LOC106567067 coding downstream 18527 41637837 ~ 41645221 (-)
calcoco1a LOC106572538 coding downstream 268080 41385586 ~ 41395668 (-)
LOC110491987 LOC106567064 coding downstream 384751 41262830 ~ 41278997 (-)
mfsd5 mfsd5 coding downstream 409965 41249937 ~ 41253783 (-)
znf740b LOC106567069 coding upstream 24197 41688246 ~ 41697155 (-)
zgc:174906 LOC106567072 coding upstream 36346 41700395 ~ 41704276 (-)
spryd3 LOC106567075 coding upstream 67143 41729589 ~ 41814584 (-)
LOC110492013 LOC106567078 coding upstream 188578 41852627 ~ 41857489 (-)
LOC110492014 LOC106567079 coding upstream 198337 41862386 ~ 41879805 (-)
G1375479 NA non-coding downstream 53391 41610117 ~ 41610357 (-)
G1375396 hoxc10aa non-coding downstream 169671 41489002 ~ 41494077 (-)
G1375395 NA non-coding downstream 181462 41481877 ~ 41482286 (-)
G1374850 NA non-coding downstream 207137 41456386 ~ 41456611 (-)
G1374790 NA non-coding downstream 263594 41363933 ~ 41400154 (-)
G1375541 NA non-coding upstream 174377 41838426 ~ 41841200 (-)
G1375561 NA non-coding upstream 187987 41852036 ~ 41852546 (-)
G1375576 NA non-coding upstream 200183 41864232 ~ 41952990 (-)
G1375583 LOC107714922 non-coding upstream 221960 41886009 ~ 41887418 (-)
G1374491 LOC106567058 other downstream 634342 41026775 ~ 41029406 (-)
rps26 LOC106567051 other downstream 809159 40852758 ~ 40854671 (-)
G1374237 LOC106567042 other downstream 1138470 40522997 ~ 40525278 (-)
LOC110491948 LOC106567031 other downstream 1578922 40080690 ~ 40119070 (-)
G1373490 LOC100380641 other downstream 1720720 39940222 ~ 39943028 (-)
LOC110492054 LOC106567113 other upstream 889510 42548642 ~ 42569532 (-)
LOC110492059 LOC106567118 other upstream 1108257 42767849 ~ 42773348 (-)
LOC110491060 LOC106567122 other upstream 1454839 43117471 ~ 43124619 (-)
G1376748 NA other upstream 1495463 43159512 ~ 43170042 (-)

Expression


G1375495 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1375495 Expression in each Bioproject

Bar chart with 18 bars.
G1375495 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network