G1378656



Basic Information


Item Value
gene id G1378656
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 44792294 ~ 44792544 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1574873
gagagagagaggtaaagagagagaggtaaagagagagagagagggagagagagagaggtagagagagagagaggtaaagagagagagaggtagagagagagcggtaaagagagagaggtaaagagcgagaggtagagagagagagagggagagagagaggtagagagagagaggtagggagagaggtagagagaggtaaagag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1574873 True 203 lncRNA 0.50 2 44792294 44792544
Loading

Neighbor


gene id symbol gene type direction distance location
cd34a cd34a coding downstream 196081 44560201 ~ 44596213 (-)
LOC110492088 NA coding downstream 251537 44538351 ~ 44540757 (-)
LOC118939541 NA coding downstream 297026 44489262 ~ 44495268 (-)
LOC110492087 NA coding downstream 326553 44461373 ~ 44465741 (-)
LOC110492085 ptn12 coding downstream 342800 44429876 ~ 44449494 (-)
LOC110492092 LOC106567333 coding upstream 511176 45303720 ~ 45307537 (-)
LOC110492093 LOC106567160 coding upstream 515802 45308346 ~ 45315784 (-)
slc48a1a LOC106567162 coding upstream 523404 45315947 ~ 45320378 (-)
itga5 LOC106567163 coding upstream 585721 45378265 ~ 45432804 (-)
LOC118939605 NA coding upstream 663018 45455562 ~ 45455616 (-)
G1378654 NA non-coding downstream 7281 44784799 ~ 44785013 (-)
G1378652 NA non-coding downstream 11314 44780781 ~ 44780980 (-)
G1378644 NA non-coding downstream 28126 44763965 ~ 44764168 (-)
G1378637 NA non-coding downstream 38508 44753516 ~ 44753786 (-)
G1378636 NA non-coding downstream 44379 44747490 ~ 44747915 (-)
G1378668 NA non-coding upstream 29282 44821826 ~ 44822034 (-)
G1378676 NA non-coding upstream 49996 44842540 ~ 44842747 (-)
G1378677 NA non-coding upstream 50462 44843006 ~ 44843310 (-)
G1378684 NA non-coding upstream 57941 44850485 ~ 44850746 (-)
G1378692 NA non-coding upstream 66951 44859495 ~ 44859796 (-)
G1378530 NA other downstream 238747 44553014 ~ 44553547 (-)
G1377482 NA other downstream 1099456 43692320 ~ 43692838 (-)
G1376991 NA other downstream 1453739 43337162 ~ 43338555 (-)
LOC110492063 LOC106567124 other downstream 1567911 43217803 ~ 43243705 (-)
G1376748 NA other downstream 1622252 43159512 ~ 43170042 (-)
plxna2 LOC106567158 other upstream 125469 44621739 ~ 44964691 (-)
LOC110492109 LOC106567177 other upstream 825673 45613938 ~ 45627786 (-)
G1380431 NA other upstream 912566 45705110 ~ 45705453 (-)
LOC110492748 ppdpf other upstream 1624016 46416560 ~ 46419996 (-)

Expression


G1378656 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1378656 Expression in each Bioproject

Bar chart with 7 bars.
G1378656 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network