G1379941


Basic Information

Item Value
gene id G1379941
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 46820495 ~ 46865266 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1576304
ggcttgatgcaggagacatggaagaccgggtggacgcgacgaaggtatcgcggaagaagaagtcgaactgcgacaggattaatgacccgagaaatacggaacggaccaatgaaccgcggggtcaacttgcgagaagccgtcttaaggggaaggttctgagtggagagccaaactctctgaccgcgacaatatctaggactcttagttctacgcttattagcagctctcacagtctgcgccctataacggcaaagtgcagacctgaccctcttccaggtgcgctcgcaacgttggacaaaagcctgagcggaggggacgctggactcggcgaactgagatgagaacaacggaggctggtacccgaggctactctgaaaaggagatagcccggtcgcagacgaaggaagcgagttgtgggcgtattctgcccaggggagctgttctgaccaagacgcagggttacgaaaagaaagactgcgtaagatgcgaccaatagtctgattggcccgttctgcttgaccgttagactgggggtgaaagccggaagagagactgacggaagccccaatcaaacggcaaaactccctccaaaattgagacgtgaattgcggacctctgtccgaaacgacgtctgacggaaggccatgaattctgaaaacattctcgatgatgatttgtgccgtctctttagcagaaggaagcttagcaaggggaatgaaatgagccgccttagagaacctatcgacaaccgtaagaataacagtcttccccgctgacgaaggcagtccggtgacaaaatctaaggcgatgtgagaccacggtcgagagggaatgggaagcggcctgagacggccggcaggaggggagttaccggacttagtctgcgcgcagaccgaaca

Function

NR:

description
PREDICTED: uncharacterized protein LOC109200937 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1576304 True 899 TUCP 0.54 2 46820495 46865266
Loading

Neighbor

gene id symbol gene type direction distance location
pqbp1 pqbp1 coding upstream 45331 46770680 ~ 46775164 (+)
LOC110492762 fkb1a coding upstream 220887 46590275 ~ 46601350 (+)
LOC110492763 LOC106567227 coding upstream 230554 46582628 ~ 46589941 (+)
LOC110492761 LOC106567345 coding upstream 247804 46567850 ~ 46572691 (+)
emilin3a LOC106567224 coding upstream 276377 46539576 ~ 46544118 (+)
LOC110492776 LOC106567237 coding downstream 58181 46923447 ~ 46942448 (+)
LOC118939461 NA coding downstream 77168 46942434 ~ 46944997 (+)
LOC110492778 LOC106567239 coding downstream 129751 46995017 ~ 46998289 (+)
LOC110492779 LOC106567241 coding downstream 134462 46999728 ~ 47013299 (+)
LOC110492781 LOC106572373 coding downstream 151723 47016989 ~ 47024062 (+)
G1379917 LOC106567235 non-coding upstream 40052 46777675 ~ 46780443 (+)
G1379916 NA non-coding upstream 44036 46775886 ~ 46776459 (+)
G1379909 NA non-coding upstream 54744 46765101 ~ 46765751 (+)
G1379907 NA non-coding upstream 55547 46763805 ~ 46764948 (+)
G1379879 LOC106567232 non-coding upstream 86248 46727100 ~ 46734247 (+)
G1379977 NA non-coding downstream 25816 46891082 ~ 46891742 (+)
G1379986 NA non-coding downstream 56889 46922155 ~ 46922435 (+)
G1380011 NA non-coding downstream 127493 46992759 ~ 46993039 (+)
G1380023 LOC106567244 non-coding downstream 164330 47029596 ~ 47032063 (+)
tuba5 LOC106572477 other upstream 627766 46185921 ~ 46193971 (+)
G1379272 NA other upstream 1113046 45705739 ~ 45707449 (+)
G1377698 NA other upstream 2639320 44144188 ~ 44181175 (+)
ubxn10 ubxn10 other upstream 3078989 43740654 ~ 43742224 (+)
G1376652 NA other upstream 3726735 43093501 ~ 43093760 (+)
G1379959 LOC106567238 other downstream 79991 46945257 ~ 46948217 (+)
LOC110491080 LOC106572377 other downstream 160856 47026122 ~ 47029192 (+)
LOC110492164 mitf other downstream 1416944 48282132 ~ 48331926 (+)
LOC110492179 NA other downstream 2159665 49024001 ~ 49034167 (+)
LOC110492182 LOC106566913 other downstream 2380316 49202107 ~ 49258042 (+)

Expression

G1379941 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G1379941 Expression in each Bioproject

Bar chart with 20 bars.
G1379941 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network