G1382894 (mitf)


Basic Information

Item Value
gene id G1382894
gene name mitf
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 48282213 ~ 48312958 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1579549
ACCTTCAGCACCTCCATGGGCAGCTGGGATGCGGGGGGCAGGCTGGGAGGAGCGCTGACATTGATGGCCGGTGTCTGGCCGTGCGTGCGATTGTGGGCGGCAGTGATCTTTGGGTACTGTGAGGTGGAGGAGGCCTGGCGTCTCTGCTGCTCCCGCCGCTCCTGCTCCTGGAGCTGCTCTCGCATCAACTGCTGCCGCAGCAGGATCCGTGATGTTGTGGTCGAGGAGCCCAATGGGGGCTTGGAAGATGAGCATGGCTGGTCTGAAGGATTACTGCTTTTTTTTCAAGGGCTGACTCTTCAATTCGTAATACGTTTTTGGTTCCTCTTGAAACTCTTCTCCAACCTCGAAGTCAGGAACTATTCCGGATTCTGCTTGCATACTTGCCACTGTCAACTCTTGACAATAACAAATTATAAAGAAACGAACGATGGTATGGCCACCTCTCTAAAACACTCGCAGTACAAGCCACTGAAATCGCAAACCCGTCTTGCTCCG

Function

symbol description
mitf Enables DNA-binding transcription activator activity, RNA polymerase II-specific and E-box binding activity. Involved in several processes, including negative regulation of cell migration; positive regulation of gene expression; and regulation of transcription, DNA-templated. Located in cytoplasm and nucleus. Part of protein-containing complex. Implicated in Tietz syndrome; Tietze's syndrome; Waardenburg syndrome type 2A; Waardenburg's syndrome; and familial melanoma. Biomarker of melanoma.

NR:

description
microphthalmia-associated transcription factor-like isoform X4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1579549 True 498 TUCP 0.54 2 48282213 48312958

Neighbor

gene id symbol gene type direction distance location
LOC110492160 frmd4b coding downstream 9924 48242058 ~ 48272289 (-)
LOC110492161 lmod3 coding downstream 40717 48232398 ~ 48241496 (-)
LOC110492159 uba3 coding downstream 52002 48220758 ~ 48230211 (-)
LOC118939552 NA coding downstream 69993 48208293 ~ 48212220 (-)
LOC110491083 fam19a4 coding downstream 85516 48184977 ~ 48196697 (-)
LOC110492165 LOC106567279 coding upstream 20962 48333920 ~ 48343017 (-)
LOC110492167 NA coding upstream 30174 48343132 ~ 48347885 (-)
LOC110492168 foxp1 coding upstream 35509 48348467 ~ 48371945 (-)
LOC110492170 eif4e3 coding upstream 59079 48372037 ~ 48383460 (-)
LOC110492173 LOC106567285 coding upstream 170512 48483470 ~ 48521507 (-)
G1382876 NA non-coding downstream 59202 48222577 ~ 48223011 (-)
G1382875 NA non-coding downstream 64173 48217820 ~ 48218040 (-)
G1382873 NA non-coding downstream 68103 48213704 ~ 48214110 (-)
G1382872 NA non-coding downstream 68579 48213334 ~ 48213634 (-)
G1382933 mitf non-coding upstream 10861 48323819 ~ 48324138 (-)
G1382935 NA non-coding upstream 13104 48326062 ~ 48326372 (-)
G1382937 NA non-coding upstream 14219 48327177 ~ 48327582 (-)
G1382938 mitf non-coding upstream 14988 48327946 ~ 48331925 (-)
G1382721 NA other downstream 335991 47943379 ~ 47946222 (-)
LOC110492148 LOC106567259 other downstream 833348 47409235 ~ 47908274 (-)
LOC110492137 LOC106567248 other downstream 1192683 47081938 ~ 47089563 (-)
G1381036 NA other downstream 1403067 46878611 ~ 46879146 (-)
LOC110491077 LOC106567232 other downstream 1520747 46724969 ~ 46761466 (-)
LOC110492187 LOC106936674 other upstream 871350 49179653 ~ 49196706 (-)
LOC110491086 LOC106566907 other upstream 1290160 49576512 ~ 49719539 (-)
G1384875 NA other upstream 1751863 50064821 ~ 50065817 (-)
G1385645 NA other upstream 2742673 51055631 ~ 51056061 (-)
G1385888 NA other upstream 2777687 51090645 ~ 51128648 (-)

Expression


Co-expression Network