G1384554



Basic Information


Item Value
gene id G1384554
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 49556496 ~ 49557490 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1581416
cctatataaacgtaggtagatgacgttcatacctatataaacgtaggtagatgacgtgcatacctatataaacgtaggtagatgacgtgcatacctatataaacgtaggtagatgacgtccatacctatataaacgtaggtagatgacgtgcatacctatataaacgtaggtagatgacgtgccatacctatataaacgtaggtagatgacgtccatacctatataacgtaggtagatgacgtgcatacctatataacgtaggtagatgacgtacatacctatataaacgtaggtagatgacgtccatacctatataaacgt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1581416 True 322 lncRNA 0.38 3 49556496 49557490
Loading

Neighbor


gene id symbol gene type direction distance location
si:ch73-217n20.1 LOC106566909 coding downstream 13139 49534880 ~ 49543357 (-)
LOC110492195 LOC106566910 coding downstream 39228 49409128 ~ 49517268 (-)
LOC110492191 NA coding downstream 296860 49258037 ~ 49259636 (-)
LOC110492187 LOC106936674 coding downstream 359790 49179653 ~ 49196706 (-)
LOC110492186 LOC106566918 coding downstream 396645 49146817 ~ 49159851 (-)
LOC110491086 LOC106566907 coding upstream 19022 49576512 ~ 49719539 (-)
LOC110492200 rprd1b coding upstream 228157 49785647 ~ 49789953 (-)
LOC110492201 LOC106566903 coding upstream 244493 49801983 ~ 49833165 (-)
LOC110492202 LOC106566902 coding upstream 282608 49840098 ~ 49880822 (-)
LOC110491088 LOC106566900 coding upstream 369974 49927464 ~ 49933750 (-)
G1384400 NA non-coding downstream 166222 49384035 ~ 49390274 (-)
G1384420 NA non-coding downstream 251363 49303471 ~ 49305133 (-)
G1384397 NA non-coding downstream 277998 49277989 ~ 49278498 (-)
G1383506 NA non-coding downstream 304557 49251696 ~ 49251939 (-)
G1384695 NA non-coding upstream 211071 49768561 ~ 49768975 (-)
G1384703 LOC106566904 non-coding upstream 216513 49774003 ~ 49775982 (-)
G1384896 NA non-coding upstream 540512 50098002 ~ 50103021 (-)
G1384934 NA non-coding upstream 651818 50209308 ~ 50210181 (-)
G1384933 NA non-coding upstream 654011 50211501 ~ 50215831 (-)
G1382894 mitf other downstream 1243538 48282213 ~ 48312958 (-)
G1382721 NA other downstream 1610274 47943379 ~ 47946222 (-)
LOC110492148 LOC106567259 other downstream 2107631 47409235 ~ 47908274 (-)
LOC110492137 LOC106567248 other downstream 2466966 47081938 ~ 47089563 (-)
G1384875 NA other upstream 507331 50064821 ~ 50065817 (-)
G1385645 NA other upstream 1498141 51055631 ~ 51056061 (-)
G1385888 NA other upstream 1533155 51090645 ~ 51128648 (-)
dffb LOC106566885 other upstream 1555913 51113403 ~ 51117850 (-)

Expression


G1384554 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1384554 Expression in each Bioproject

Bar chart with 16 bars.
G1384554 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network