G1384695



Basic Information


Item Value
gene id G1384695
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 49768561 ~ 49768975 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1581564
CTCTAGGGGTCTAACTGATGGAGCTGCAGCCAGTCCTGGTGGCTGTAGGACAGGGTGTCTTCTAGGGGCCTACCTGATGGAGCTGCAGTCAGTCCTGGTGGCTGTAGGACAGGGTGTCCTCTAGGGGTCTAACTGATGGAGCTGCAGTCAGTCCTGGTGGCTGTAGGACAGGGTGTCCTCTAGGGGCCTACCTGATGGAGCTGCAGTCAGTCCTGGTGGCTGTAGGGCAGGGTGCCCTCTAGGGGCCTACCTGATGGAGCTGCAGTCAGTCCTGGTGGCTGTAGGACAGGGTGTCCTC

Function


NR:

description
uncharacterized protein KIAA1755-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1581564 True 298 lncRNA 0.60 2 49768561 49768975

Neighbor


gene id symbol gene type direction distance location
LOC110491086 LOC106566907 coding downstream 165121 49576512 ~ 49719539 (-)
pfkfb2a LOC106566908 coding downstream 197845 49553160 ~ 49570716 (-)
si:ch73-217n20.1 LOC106566909 coding downstream 225204 49534880 ~ 49543357 (-)
LOC110492195 LOC106566910 coding downstream 251293 49409128 ~ 49517268 (-)
LOC110492191 NA coding downstream 508925 49258037 ~ 49259636 (-)
LOC110492200 rprd1b coding upstream 16672 49785647 ~ 49789953 (-)
LOC110492201 LOC106566903 coding upstream 33008 49801983 ~ 49833165 (-)
LOC110492202 LOC106566902 coding upstream 71123 49840098 ~ 49880822 (-)
LOC110491088 LOC106566900 coding upstream 158489 49927464 ~ 49933750 (-)
e2f1 LOC106566901 coding upstream 164104 49933079 ~ 49938888 (-)
G1384554 NA non-coding downstream 211071 49556496 ~ 49557490 (-)
G1384400 NA non-coding downstream 378287 49384035 ~ 49390274 (-)
G1384420 NA non-coding downstream 463428 49303471 ~ 49305133 (-)
G1384397 NA non-coding downstream 490063 49277989 ~ 49278498 (-)
G1384703 LOC106566904 non-coding upstream 5028 49774003 ~ 49775982 (-)
G1384896 NA non-coding upstream 329027 50098002 ~ 50103021 (-)
G1384934 NA non-coding upstream 440333 50209308 ~ 50210181 (-)
G1384933 NA non-coding upstream 442526 50211501 ~ 50215831 (-)
G1384994 NA non-coding upstream 447134 50216109 ~ 50216338 (-)
LOC110492187 LOC106936674 other downstream 572235 49179653 ~ 49196706 (-)
G1382894 mitf other downstream 1455603 48282213 ~ 48312958 (-)
G1382721 NA other downstream 1822339 47943379 ~ 47946222 (-)
LOC110492148 LOC106567259 other downstream 2319696 47409235 ~ 47908274 (-)
G1384875 NA other upstream 295846 50064821 ~ 50065817 (-)
G1385645 NA other upstream 1286656 51055631 ~ 51056061 (-)
G1385888 NA other upstream 1321670 51090645 ~ 51128648 (-)
dffb LOC106566885 other upstream 1344428 51113403 ~ 51117850 (-)
LOC110492226 LOC106572002 other upstream 2214159 51978399 ~ 51990025 (-)

Expression


G1384695 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1384695 Expression in each Bioproject

Bar chart with 7 bars.
G1384695 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network